Labshake search
Citations for Illumina :
401 - 450 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Basecalling was done by Illumina RTA3 and output was demultiplexed and converted to fastq format with bcl2fastq v1.9.0.
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced on an Illumina MiSeq or NovaSeq using custom sequencing primers (R1 - U6-Illumina-seq2 - TCTTCCGATCTCTTGTGGAAAGGACGAAACACCG and R2 - iScaffold-Illumina-seq3 - GCTCTTCCGATCTGCTGTTTCCAGCATAGCTCTTAAAC)
-
bioRxiv - Neuroscience 2024Quote: ... Sequencing of the libraries was carried out using HiSeq X Ten (Illumina).
-
bioRxiv - Microbiology 2024Quote: ... The V4 – V5 region of the 16S rRNA gene was amplified with the 515F/926R primer pair (45,46) and sequenced on the MiSeq platform (Illumina, Inc., San Diego, CA).
-
bioRxiv - Microbiology 2024Quote: ... v2 Kit (Illumina Inc.), resulting in high-quality reads ranging from 11 to 17 million reads per sample (Table S3 ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA-Seq libraries were generated from 200 ng of total RNA using TruSeq Stranded mRNA Library Prep Kit and TruSeq RNA Single Indexes kits A and B (Illumina, San Diego, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA libraries were sequenced using NovaSeq6000 (Illumina) at LabGenomics (Seongnam ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was submitted to the University of Michigan Advanced Genomics Core for library preparation and RNA-sequencing (Illumina NovaSeq platform ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed by GenoScreen (Lille, FR) on MiSeq (Illumina 2*250 bp) using the MiSeq reagent kit v2 (500 cycles).
-
bioRxiv - Microbiology 2024Quote: ... and NextSeq (Illumina) genome sequencing instrument was used to sequence the samples ...
-
bioRxiv - Microbiology 2024Quote: ... regions ITS1-ITS2 were constructed using a dual-indexing method and sequenced on a MiSeq platform with a 2x300 bp run format (Illumina, San Diego, CA) at the University of Wisconsin – Madison Biotechnology Center ...
-
bioRxiv - Microbiology 2024Quote: ... followed by library preparation using the Illumina DNA Prep kit (Illumina, San Diego, CA) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2024Quote: ... Library preparations were made using the Nextera Flex Prep HT kit (Illumina) and samples were then sequenced on the Illumina NovaSeq X-Plus (300 cycles).
-
bioRxiv - Microbiology 2024Quote: ... All samples were pooled and run on a NovaSeq 6000 (Illumina) with V1.5 sequencing kits for 151 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... and shotgun-sequenced using the Illumina MiSeq platform with a read length of 2 × 150 bp (Illumina, San Diego, CA, USA). For each phage ...
-
bioRxiv - Developmental Biology 2024Quote: ... The final pools were sequenced on NovaSeq 6000 platform using SP Reagent Kit v1.5/ 100 cycles (Illumina) with 28×8×91 configuration run leading to 40000 reads/cell.
-
bioRxiv - Developmental Biology 2024Quote: ... Multiplexed libraries were sequenced using a NextSeq 500 (Illumina) to generate 75-nt single-end reads ...
-
bioRxiv - Microbiology 2024Quote: Paired FASTQ files from Illumina paired-end sequencing were merged using AdapterRemoval67 (v ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were sequenced with a MiSeq (Illumina) using the reagent kit v3 (PE 2x300 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The library was sequenced on an Illumina NextSeq500 instrument with a high-output mode (Illumina, 20024907) 150bp paired-end reading strategy according to 10X recommendations.
-
bioRxiv - Molecular Biology 2024Quote: ... QHR-4C libraries were constructed with specific primer pairs (forward primers containing Illumina P5 with sequences near a specific viewpoint and reverse primers containing Illumina P7 with an index and sequences matching the adapter ...
-
bioRxiv - Developmental Biology 2024Quote: ... sequencing was carried out on the NextSeq 500 platform (Illumina) employing the paired-end 36-base read option ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were sequenced on the NovaSeq platform (Illumina).
-
bioRxiv - Microbiology 2024Quote: ... The RNA was treated with the QIAseq FastSelect 5S/16S/23S rRNA removal kit prior to library prep with the TruSeq Stranded Total RNA Library Prep Kit (Illumina, CA, USA). The Illumina HISeq 4000 was used for sequencing at 50bp single-end reads.
-
bioRxiv - Microbiology 2024Quote: ... and 0.2 µg/µL of DNA was sequenced by Illumina MiSeq runs (Illumina Inc. ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.2 µg/µL of DNA was sequenced by Illumina MiSeq runs (Illumina Inc., San Diego, USA). DNA was fragmented and amplified by limited PCR (12 cycles) ...
-
bioRxiv - Cell Biology 2024Quote: ... The library pool was denatured with NaOH and was finally diluted to 1.8 pM according to the Denature and Dilute Libraries Guide (Document #15048776 v02, Illumina, US). 1.3 ml of the denatured pool was loaded on an Illumina NextSeq 550 sequencer using a High Output Flowcell (400M cluster ...
-
bioRxiv - Cell Biology 2024Quote: ... 1.3 ml of the denatured pool was loaded on an Illumina NextSeq 550 sequencer using a High Output Flowcell (400M cluster) for single reads (#20024906, Illumina, US). Sequencing was performed with the following settings-Sequence reads 1 and 2 with 38 bases each ...
-
bioRxiv - Cell Biology 2024Quote: BCL files were converted to FASTQ files using bcl2fastq Conversion Software version v2.20.0.422 (Illumina, US).
-
bioRxiv - Microbiology 2024Quote: ... The libraries were sequenced using the HiSeq 2000 system (Illumina). Two biological replications have been performed for all ChIP-seq experiments ...
-
bioRxiv - Cell Biology 2024Quote: ... from islets was added to 50 μM first-strand RT primer (the sequence at the 5’ portion corresponds to primer P7 on the Illumina flowcell), 10 mM dNTP mix ...
-
bioRxiv - Cell Biology 2024Quote: ... and then sequenced on HiSeq3000 (Illumina). Reads were then aligned to the Ensemble top-level assembly with STAR version 2.0.4b ...
-
bioRxiv - Cell Biology 2024Quote: ... Preparation of libraries was done with Ribo-Zero rRNA depletion kit (Illumina) and then sequenced on HiSeq3000 (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA amplicons and ITS amplicons were pooled separately and sequenced using the Illumina MiSeq instrument (Illumina, San Diego, CA, USA). The raw sequences were quality filtered using the Quantitative Insights into Microbial Ecology pipeline (QIIME v1.9) ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA libraries were prepared using the Nextera XT Library Prep Kit (Illumina, San Diego, USA) following the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were sequenced on an lllumina NovaSeq 2500 (Illumina, San Diego, USA) using a 250 bp paired end protocol.
-
Tryptophan Metabolites And Their Predicted Microbial Sources In Fecal Samples Of Healthy IndividualsbioRxiv - Microbiology 2024Quote: ... A set of 96 Unique dual index barcodes (Illumina TruSeq UD Indexes, # 20022370) were utilized to barcode samples ...
-
bioRxiv - Microbiology 2024Quote: ... The raw sequencing reads were demultiplexed based on sample indexes using basespace (Illumina) and the fastQ files were used for further processing ...
-
bioRxiv - Microbiology 2024Quote: ... Deep sequencing was subsequently performed using an S4 flow cell in a NovaSeq sequencing system (Illumina; average read depth ∼30 million pairs of 2×100bp reads ...
-
bioRxiv - Microbiology 2024Quote: ... samples were pooled and preliminary sequencing of cDNA libraries (average read depth of 90,000 reads) was performed using a MiSeq system (Illumina), to confirm library quality and concentration ...
-
bioRxiv - Microbiology 2024Quote: ... The libraries were then subjected to paired end sequencing on Illumina Nextseq using Nextseq Mid Output kit (Illumina) with a read length of 150 bp ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced 2x36 with an NextSeq 500/550 High Output v2.5 75 cycles kit (Illumina, 20024906) on a NextSeq 550 ...
-
bioRxiv - Molecular Biology 2024Quote: DNA methylation was analyzed using Infinium Mouse Methylation BeadChip (MMBC) Array from Illumina. DNA for MMBC (500 ng in 40 μL nuclease-free water ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μg of total RNA samples underwent treatment with the epicenter Ribo-ZeroTM Kit (Illumina, San Diego, USA) to remove rRNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... and sequenced on a NextSeq500 instrument (Illumina) at the Core Facilities of the Medical University of Vienna ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was further sequenced with a Novaseq 6000 platform (Illumina) by following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Pair-end sequencing (2x300) was done with MiSeq Reagent Kit v3 in a MiSeq platform (Illumina) by following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Pooled libraries were sequenced on a NextSeq500 instrument (Illumina) in 1×75bp single-end sequencing mode ...
-
bioRxiv - Molecular Biology 2024Quote: ... and sequenced as 125- or 250-base-pair paired end reads using Illumina Hiseq 2500 (Illumina). WGBS data were deposited under the GEO accession number GSE252760.
-
bioRxiv - Molecular Biology 2024Quote: ... RNA-sequencing libraries were prepared using Truseq stranded mRNA kit (Illumina) according to the manufacture’s protocol ...