Labshake search
Citations for Millipore Sigma :
8551 - 8600 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... composed of Egg yolk L-α-Phosphatidylcholine (EyPC, Avanti Polar), 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (POPS, Avanti Polar) and Cholesterol (Sigma) (50:20:30 ...
-
bioRxiv - Biophysics 2023Quote: ... a 10−3 M stock solution of TPPS4 was prepared by dissolving the powder (Sigma Aldrich, St. Louis, Missouri, USA) in distilled water ...
-
bioRxiv - Genetics 2022Quote: ... cells were grown in a basal erythroid medium (BEM) supplemented with hSCF, IL-3, EPO (Eprex, Janssen-Cilag) and hydrocortisone (Sigma). From day 6 to 20 ...
-
bioRxiv - Genomics 2023Quote: ... Frozen cells were thawed and added to a Dounce homogenizer containing 1 mL of nuclei isolation buffer (NIB: 10 mM TrisHCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% Igepal (Millipore Sigma #18896), and 1 x protease inhibitors (Millipore Sigma #118735800001)) ...
-
bioRxiv - Immunology 2023Quote: ... Mice were maintained on a purified diet (‘AhR-poor diet’, AIN-93M, Safe diets) supplemented or not in Indole-3-carbinol (I3C, 200 ppm, Sigma). In some experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were inoculated in YEP containing 3% lactic acid and treated with a final concentration of 2% galactose (Sigma-Aldrich). For the inducible degradation of the proteins ...
-
bioRxiv - Developmental Biology 2023Quote: ... The growth medium of organoids was supplemented with 100μM with 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (8-Br-cAMP) (Sigma, #B7880) in iPSC organoids or 200μM forskolin (FSK ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cumulus oocyte complexes were collected by tearing the ampulla wall of the oviduct, placed in Ferticult medium (FertiPro N.V, Belgium) supplemented with 3 % BSA (Sigma–Aldrich), and maintained at 37°C under 5 % CO2 in air under mineral oil (FertiPro N.V ...
-
bioRxiv - Genetics 2023Quote: ... Liquid nitrogen-frozen pellets equivalent to 1 g of animals were homogenised in 3 ml of lysis buffer (Sigma-Aldrich, L3412 ...
-
bioRxiv - Microbiology 2023Quote: ... and blocked for 1 hour in PBS containing 0.1% w/v saponin-3% bovine serum albumin (BSA, Sigma Aldrich, A7906). Samples were again rinsed three times with PBS and incubated with primary antibodies as indicated in Table S5D ...
-
bioRxiv - Microbiology 2023Quote: ... Protein was then eluted off the agarose by resuspension in 100 µL of 3X FLAG elution buffer (3 µL of 5 mg/mL Sigma 3X FLAG peptide solution + 97 µL of coIP buffer 2 ...
-
bioRxiv - Immunology 2023Quote: ... followed by streptavidin-Cyanine-3 (1:500; Amersham Bioscience) or by goat anti-human IgG coupled to FITC (1:100, Sigma), as appropriate ...
-
bioRxiv - Immunology 2023Quote: ... ex vivo isolated naïve or overnight stimulated (anti-CD40 at 5μg/ml and IL-4 at 1ng/ml) 3×105 B cells were plated on a poly-D lysine (PDL) (Sigma)-coated XF96 cell culture microplate and incubated at 37 °C for a minimum of 30 min in a CO2-free incubator in assay medium (XF RPMI medium pH 7.40 supplemented with 2 mM L-glutamine ...
-
bioRxiv - Plant Biology 2023Quote: ... The 30 collected fractions were combined into 15 pools and desalted on C18 Cartridges (Empore SPE Cartridges C18 standard density, bed I.D. 7 mm, volume 3 ml, Sigma-Aldrich). Each fraction was concentrated by vacuum centrifugation and reconstituted in 40 µl of 0.1% (v/v ...
-
bioRxiv - Microbiology 2023Quote: MDCK cells (2 x 105 cells) were cultured on polycarbonate Millicell culture plate inserts (12- mm diameter, 3-µm pore size; Merck Millipore) at 37°C under 5% CO2 atmosphere.
-
bioRxiv - Cell Biology 2023Quote: Lipid overlay assay PI strips were blocked in PBST (0.1% Tween 20 [v/v]) supplemented with 3% (w/v) fatty acid-free BSA (Sigma-Aldrich) overnight at 4°C and then incubated with 0.5 μg/ml GST fusion proteins for 1 h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... diluted to 20 µg mL-1 in 10 mM Tris-SO4 (pH 7.5) and 250 mM sucrose and supplemented with 3 µM horse heart cytochrome c (Sigma Aldrich). For measurement of NADH:O2 oxidoreduction ...
-
bioRxiv - Bioengineering 2023Quote: iLPC organoids formed after 48 hours post-seeding were fixed for 3 hours in 4% paraformaldehyde (PFA) in phosphate buffered saline (PBS) (Sigma), before a double-embedding process in 1.5% agarose gel then paraffin as described previously [13 ...
-
bioRxiv - Cell Biology 2023Quote: ... The calvarias were shredded to 1 mm × 1 mm pieces and digested for 30 min at 37 °C in Dulbecco’s modifiation of Eagle’s medium (DMEM, Gibico, USA) with 3 mg/ml collagenase I (Sigma-Aldrich, Germany) and 0.25% trypsin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were again washed 3 × 5 min with PBS + 0.1% Tween 20 and incubated with Classico/Crescendo Western HRP substrate (Millipore-Sigma) for 2 min ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified proMMP-3 and mutants were activated for 16 h in the presence of 1 mM 4-amino-phenyl mercuric acetate (Sigma) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Then the brains were dissected to 2 mm slices and incubated for 10 minutes in freshly prepared 0.5% TTC solution (2, 3, 5-Triphenyltetrazolium chloride, Sigma-Aldrich). Afterward ...
-
bioRxiv - Molecular Biology 2023Quote: ... Preparative scale reactions were carried out in 3 mL Slide-A-Lyzer cassettes (10 kDa MWCO, Merck Millipore, Darmstadt, Germany) in combination with custom-made FM containers57 ...
-
The aryl hydrocarbon receptor in β-cells mediates the effects of TCDD on glucose homeostasis in micebioRxiv - Molecular Biology 2023Quote: ... n = 3 – 9 mice / group) were transferred to a 1.5 mL microcentrifuge tube and washed with pre-warmed PBS+/+ (Sigma, # D8662). Islets were dispersed by adding 400 µl Accutase (VWR ...
-
bioRxiv - Cancer Biology 2023Quote: ... two to four-month-old mice were gavaged 3 times over 5 days with 2 mg tamoxifen (TX; Sigma #T5648) in corn oil (Sigma #C8267) ...
-
bioRxiv - Genomics 2023Quote: ... Expression of the Dam-POI in the mouse ESC lines was suppressed by addition of 0.5 mM indole-3-acetic acid (IAA; Sigma, I5148).
-
bioRxiv - Cell Biology 2023Quote: ... when embryoid bodies were formed) half of the medium was replaced with differentiation medium supplemented with 3 μM IWR-1-Endo (Sigma), 1 μM Dorsomorphin (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 mm3 tissue pieces from 2-3 brains were pooled and enzymatically digested in a dissociation medium containing 0.16 mg/mL cysteine (Sigma C9768), 7 U/mL Papain (Sigma P3125) ...
-
bioRxiv - Pathology 2023Quote: Mouse epidydimal adipose tissue was harvested and digested in Hanks’ Balanced Salt Solution (HBSS, no calcium and magnesium) containing fetal bovine serum (FBS,3%) and collagenase D (2.5 mg/ml, Sigma-Aldrich) for 30 minutes at 37°C under agitation ...
-
bioRxiv - Neuroscience 2023Quote: Cells were fixed in 4% paraformaldehyde and permeabilized/blocked using PBS with 3% goat or donkey serum and 0.2% triton X-100 (Sigma Aldrich). Cells were incubated at 4°C overnight with primary antibodies against the following targets ...
-
bioRxiv - Microbiology 2023Quote: The synthetic positive control had the sequence: 5’ – TCCTAAAGCACCACGCAGCATCTATCGCGAGCTTAATCACCATGCCGCGTCCAACGCGATCCCCGCTCGGCAGGGATC CCTCTTCTCGCACCGGGCCACAATCCACTGGGGTCGCTATGA – 3’ and was synthesised as an ssDNA oligo (Sigma-Aldrich). The synthesised IS2404 synthetic positive was resuspended in nuclease-free water and diluted to 0.001 pM ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviruses were generated by transfecting 3 x 106 HEK-293T cells in antibiotic-free medium with 6 µg of total DNA in a 1:2:3 ratio of pMD2.G:psPAX2:transfer plasmid using polyethylenimine (PEI) (Sigma-Aldrich). 48 h after transfection ...
-
bioRxiv - Microbiology 2024Quote: ... Cultures were diluted 1 in 100 in a 3 mL volume of YPD and compounds were added to final concentrations of 1 µg/mL for Rhodamine 6G (Sigma), or 1 µM for FLC-Cy5 ...
-
bioRxiv - Systems Biology 2024Quote: ... 2M thiourea, 100mM Tris-HCl, pH 8, 150mM NaCl, 1mM EDTA, phosphatase inhibitor cocktail 2 and 3, 10mM NaF; Sigma), reduced with 10mM DTT (dithiothreitol ...
-
bioRxiv - Systems Biology 2024Quote: ... and kept at 4°C for a maximum of 4 hours until plasma was separated via centrifugation (2600g for 10 minutes at 4°C) (Sigma 3-16KL, Sigma Laboratory Centrifuges ...
-
bioRxiv - Immunology 2024Quote: ... Fetuin-coated plates were then washed 3 times with PBS-T and incubated for 1 h with a solution of PNA-HRP (cat. # L6135-1MG, Sigma) at 5 μg/ml in conjugate diluent (MES pH 6.5 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The cells were washed 3 times with 1×PBS and then permeabilized with 0.125% TritonX-100 (Sigma Aldrich, no. 93443) in 1×PBS for 2 min ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2-(14-carboxytetradecyl)-2-ethyl-4,4-di methyl-3-oxazolidinyloxy (16-doxyl-stearicacid, 16-DSA, cat. no. 253596) from Sigma-Aldrich. 5-DSA (spin probe containing the nitroxide group attached on C5 that is located on the opposite terminal relative to the charged carboxyl fatty acid terminus ...
-
bioRxiv - Immunology 2024Quote: ... before microtubule-associated protein light chain 3 (LC3)-I and LC3-II levels in cell lysates was analysed by immunoblotting (rabbit polyclonal LC3 antibody, Sigma).
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... samples were rinsed 5 × 3 min with double distilled water (ddH2O) and subsequently exposed to 1% aqueous thiocarbohydrazide (TCH) (#88535 Sigma) solution for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... pneumoniae serotype 3 (ST3) with or without addition of either Hyaluronidase from bovine testes Type I-S (H3506 Sigma-Aldrich, St ...
-
bioRxiv - Microbiology 2023Quote: ... and the metal-loaded polymer purified and washed in C-buffer using an Amicon Ultra-0.5 centrifugal filter unit with 3 kDa cutoff (Millipore-Sigma). At the same time ...
-
bioRxiv - Immunology 2023Quote: ... The samples were acidified the next day using formic acid to bring pH<3 to stop the trypsin activity and were processed through Zip-Tip using C18 tips (Millipore) to clean-up and concentrate the peptides before going through mass spec analysis.
-
bioRxiv - Molecular Biology 2023Quote: ... rASRA was then concentrated and buffer-exchanged into PBS via an Amicon Ultra-15 Centrifugal Filter with a 3 kDa cut-off (cat#UFC900324, Millipore). rASRA was subjected to sterile filtration utilizing a COSTAR 0.22 µm Spin-X Centrifuge Tube Filter ...
-
bioRxiv - Microbiology 2023Quote: ... the blots were washed again using TBST and developed using AP-reactive Nitrobluetetrazolium (NBT) 5-bromo-4-chloro-3-indolylphosphate (BCIP) tablets (Sigma). A final image of the blots was taken on a Bio-Rad ChemiDoc gel imaging system using colorimetric detection.
-
bioRxiv - Microbiology 2023Quote: ... 10 mM EDTA) with 0.5 mg/mL lysozyme and 3 mg/mL proteinase K (Sigma-Aldrich Corp., St. Louis, MO). Resultant genomic DNA was treated with RNase A and prepared for sequencing using the Nextera XT kit (Illumina Corp. ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were fixed with 3.7% formaldehyde in PBS for 20 min and permeabilized and blocked with PBS containing 0.3% Triton X-100 and 3% BSA (Sigma-Aldrich) for 1 h at room temperature and then incubated with primary antibodies to Occludin (1:50 dilution) ...
-
bioRxiv - Genomics 2023Quote: ... with 3 mL of cell culture media added to each well and treated with 5 µM 5-azacytidine (A2385, Sigma), 10 µM dexamethasone (D1756 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Penicillin, Streptomycin, LIF and 2i (3 μM Gsk3 inhibitor CT-99021, 1 μM MEK inhibitor PD0325901) and Vitamin C (Sigma) at a final concentration of 100 μg/ml ...