Labshake search
Citations for Millipore Sigma :
8351 - 8400 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: An RNA oligonucleotide (5′ -UUUUCAUGCUACGCGUAGUUUUCUACGCG-3′; 4N) with Cyanine 5.5 at the 5′-end was obtained from Millipore Sigma (USA). The RNA scaffold was annealed in 20 mM HEPES ...
-
bioRxiv - Immunology 2020Quote: ... Sorted cells were then spun (1000 xg for 5 minutes) onto glass slides using a Shandon Cytospin 3 Cytocentrifuge (ThermoScientific) and stained with Prussian Blue and Neutral Red (Sigma). Red pulp macrophages were visualised and photographed using a Leica DM1000 light microscope (100x oil objective).
-
bioRxiv - Developmental Biology 2020Quote: ... plates of 3 mL ASW+BSA were supplemented with 1:1000 dilution of U0126 stock solutions (Sigma Cat. #662005-1MG) dissolved in DMSO to produce the indicated concentrations of U0126 ...
-
bioRxiv - Developmental Biology 2021Quote: Primary polyps were incubated in freshly filtered (0.2 μm) seawater with 3 μM calcein blue (Sigma–Aldrich 54375-47-2) for 4-5 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were removed from the egg and anaesthetised in a petri dish of seawater containing 10mg/mL ethyl 3-aminobenzoate methanesulfonate salt (MS-222, Sigma) prior to microinjection according to Gillis and Hall (2016) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Eluted protein samples were combined in one tube and desalinated using an ultrafiltration tube (Amicon Ultra 3 kDa molecular weight cut-off, Merck/Millipore) with Buffer C (50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were blocked for 1 hour in 3% BSA-TBS and incubated overnight at 4°C with the following primary antibodies: anti-phosphotyrosine 4G10 (Millipore), anti-phosphorylated SYK (pY525/526 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated during the 3 days chase period with the following compounds: Bafilomycin A1 (5-10 nM; Sigma-Aldrich), Rab7 inhibitor (CID 1067700 ...
-
bioRxiv - Cell Biology 2020Quote: ... were mixed in a 1:3 molar ratio and incubated overnight at room temperature with calf intestinal alkaline phosphatase (Sigma). After 12-18h ...
-
bioRxiv - Biophysics 2021Quote: ... DNA and RNA samples used for NMR measurements were buffer exchanged into the desired NMR buffer with final concentration ~1 mM using Amicon Ultra-0.5/15 centrifugal concentrators (3-kDa cutoff, Millipore Sigma). The samples used for optical melting experiments were prepared by diluting NMR samples to ~3 μM using buffer ...
-
bioRxiv - Immunology 2020Quote: ... 8-20 weeks after reconstitution chimeric mice were injected intraperitoneally for 3 d with 2 mg/day of tamoxifen (Sigma) re-suspended at 20 mg/ml in corn oil (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then treated with 6-thio-dG (3-5 μM) in the presence of 500 ng/ml doxycycline (Sigma), washed three times with warm PBS and allowed to recover in regular growth medium containing 500 ng/ml doxycycline ...
-
bioRxiv - Microbiology 2020Quote: ... 5 days post fertilization (dpf) zebrafish larvae were anaesthetized with 0.017% Ethyl 3-aminobenzoate methanesulfonate (MS-222, Tricaine, Sigma-Aldrich) in egg water ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM EDTA) with 0.5 mg/mL lysozyme and 3 mg/mL proteinase K (Sigma-Aldrich Corp., St. Louis, MO). To obtain sufficient DNA from AR BANK # 0943 and AR BANK # 0958 ...
-
bioRxiv - Microbiology 2019Quote: ... Ambient air was injected in the system at a flowrate of 3 L/min using an aquarium air pump equipped with a 0.2 µm air filter (Millipore, USA). Prior to the start of the experiment ...
-
bioRxiv - Immunology 2021Quote: ... Slices were transferred to Millicell-CM membrane inserts (0.4 μm pore size, 30 mm diameter, 2-3 slices per insert; Millipore Corp) in six well tissue culture treated plates containing MEM with 25% horse serum and 6.5 mg/mL of glucose ...
-
bioRxiv - Immunology 2021Quote: ... or 2 μM NH-3 in the presence of 10 nM T3 for 24 h before the addition of 3 μL of a fluorescent latex bead suspension (L0280, Sigma) in complete DMEM in a ~100:1 bead-to-cell ratio for 2 h before the end of the experiment ...
-
bioRxiv - Microbiology 2021Quote: ... harvesting at 3 dpi) using DMEM supplemented with 2% FBS and 1 μg/mL TPCK-trypsin (Sigma-Aldrich #1426-100MG). SARS-CoV and MERS-CoV viral stocks were generated by infecting VeroE6 cells (MOI 0.0001 ...
-
bioRxiv - Microbiology 2020Quote: ... 198 μl/well were transferred into 3 wells of a black 96-well plate with transparent flat bottom (Sigma Aldrich). Then ...
-
bioRxiv - Molecular Biology 2021Quote: Total splenocytes were isolated from C57BL/6 and mFICD-/- mouse spleens and then treated for 3 days with 20 μg/ml LPS (Sigma), 100 µg/ml heparan sulfate or 2.5 μM thapsigargin (Enzo Life Sciences) ...
-
bioRxiv - Molecular Biology 2021Quote: ... infected in BGM containing Adeno-GFP (1×1010) or Adeno-ADH5 (1×1012) and differentiated in BGM containing 0.25nM 3-Isobutyl-1-methylxanthine (IBMX, Sigma, I5879), 1uM Rosiglitazone (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... cells were washed with serum-free DMEM and cultured in DMEM containing 3% FBS and 1.5% sodium carboxymethyl cellulose (Sigma-Aldrich). Visible plaques were counted ...
-
bioRxiv - Microbiology 2021Quote: ... and human choriocarcinoma/trophoblastic cancer (JEG-3) cells were grown in DMEM supplemented with 10% FBS and MEM Non-essential Amino Acid Solution (Sigma). C6/36 cells were grown at 28°C in a 5% CO2 incubator ...
-
bioRxiv - Immunology 2021Quote: ... PBMCs were frozen at a concentration of 1-3×107 cells/ml in 10% DMSO (Sigma-Aldrich, St. Louis, MO)/90% FCS (Atlanta Biologicals ...
-
bioRxiv - Microbiology 2021Quote: ... RH TIR1-3FLAG or RH TgPDE-mAID-3HA tachyzoites cultivated in HFFs in D10 medium were treated with 0.5 mM 3-indoleacetic acid (auxin; IAA) (Sigma Aldrich) prepared in 100% ethanol (Pharmco ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL of lysis buffer (8M urea in 50mM Tris-Cl pH 7.5, supplemented with phosphatase inhibitor cocktail 3 [Millipore-Sigma]) was added to each of the pellets and pipetted up and down several time to lyse a portion of the pellet ...
-
bioRxiv - Immunology 2021Quote: ... and PBS-treated (n ≥ 3) control human gut xenografts and mouse jejunum were purified using GenElute Mammalian Total RNA kit (Sigma) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... and the colour reaction was carried out with NBT/BCIP (4-nitroblue tetrazolium chloride/bromo-4-chloro-3-indolyl phosphate; Sigma). Sections were dehydrated and mounted with Vectamount (Vector Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides containing the sequence 5’-TGCATGTTCTCACTGCTCCTTTACTAGCAAATACAACAGAAGACAAACCTAGTAA AGATGATTTTCAGACTGCCCAACTATTGGCACTTGTATTGGAATTGTTAACATTTT GTGTGGAGCACCATACCTACCACATAAAGAACTACATTATTAATAAGGATATCCT CCGGAGAGTGCTAGTTCTTATGGCCTCGAAGCATGCTTTCTTGGCATTATGTGCC CTTCGTTTTAAAAGAAAGATTATTGGATTAAAAGATGAGTTTTACAACCGCTACA TAATGAAAAGTTTTTTGTTTGAACCAGTAGTGAAAGCATTTCTCAACAATGGATC CCGCTACAATCTGATGAACTCTGCCATAATAGAGATGTTTGAATTTATTAGAGTG GAAGATATAAAATCATTAACTGCTCATGTAATTGAAAATTACTGGAAAGCACTG GAAGATG-3’ were used (Mission esiRNA, Sigma) and transfected into cells using Lipofectamine 2000 reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... This formulation lacked Wnt3a and R-spondin-3 but was supplemented with EGF (50 ng/mL) along with Gastrin (10 nM, Sigma), Noggin (50 ng/mL ...
-
bioRxiv - Genetics 2019Quote: ... The infectious blood meal was composed of a virus suspension diluted (1:3) in washed rabbit blood and resuspended at 50% (vol/vol) in dialyzed rabbit serum (R4505; Sigma). ATP was added to a final concentration of 5 μM ...
-
bioRxiv - Genomics 2021Quote: Fresh nuclei were incubated for 3 minutes at 37°C with limiting concentrations of the DNA endonuclease deoxyribonuclease I (DNase I) (Sigma) in buffer A supplemented with Ca2+ ...
-
bioRxiv - Cell Biology 2021Quote: ... fresh-frozen tissue sections were fixed in 4% paraformaldehyde in HBSS overnight at 4°C and treated with 0.2 N HCl for 20 minutes and subsequently with 3 μg/ml Proteinase K (#3115887001, Sigma-Aldrich) for 7 minutes at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: Confluent ESCs monolayers were decidualized in DMEM/F12 containing 2 % FBS supplemented with 0.3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP) (Sigma-Aldrich, USA), 10 nM β-Estradiol (E2 ...
-
bioRxiv - Immunology 2021Quote: ... were pelleted at 3.000g for 3 minutes and induced by resuspension in YNB-CAA + 2% D-(+)-Galactose (Sigma G0625-500G) + phosphate buffer + P/S induction medium at a final OD600 of 0.5 ...
-
bioRxiv - Genetics 2021Quote: ... The plasmids for inducible expression of the human CNBP counterpart was generated by cloning the FLAG epitope CDS fused in-frame with the 3′ end of the hCNBP CDS (CNBP-201 splice variant, CCDS 3056.1) into the UAS-attB vector (Genewiz, SIGMA-ALDRICH). The dCNBP-3HA-res or UAS-hCNBP-FLAG were injected in y1 w67c23 ...
-
bioRxiv - Cell Biology 2021Quote: ... sphere (1.5 μm – 3 μm)) coated with 8.45 mM poly(ethylene glycol)methyl ether thiol (Mn 800, Cat. No. 729108, Sigma Aldrich) solution for 2 h at room temperature were used ...
-
bioRxiv - Microbiology 2022Quote: ... and the ampicillin media was stained by adding 5 µl and 3 µl of a fluorescent dye (rhodamine, Sigma S1402) in 100ml of media used to grow MG:GT and MG/pBGT cells ...
-
bioRxiv - Neuroscience 2022Quote: Larvae were anesthetized in 0.2 mg/mL ethyl-3-aminobenzoic acid ethyl ester (MESAB, Sigma-Aldrich E10521, St. Louis, MO) prior to imaging except where noted ...
-
bioRxiv - Cell Biology 2022Quote: ... and transferred to 1.5 ml Eppendorf tubes where the cells were fixed for a minimum of one hour or overnight in 3% formaldehyde (Sigma) in PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... Labelled XIAP BIR2AG124-240 was directly concentrated on 3 KDa molecular weight cut off Centricon centrifugal filter units (EMD Millipore) until 300 μL at 240 μM were obtained.
-
bioRxiv - Biophysics 2022Quote: ... The UBF solution was supplemented with 10% glycerol and concentrated in Amicon Ultra 3 MWCO (molecular weight cut-off) concentrator columns (Millipore-Sigma UFC 500396 - hereafter called Amicon concentrators) ...
-
bioRxiv - Biophysics 2022Quote: ... The UBF solution was supplemented with 10% glycerol and concentrated in Amicon Ultra 3 MWCO (molecular weight cut-off) concentrator columns (Millipore-Sigma UFC 500396 - hereafter called Amicon concentrators) ...
-
bioRxiv - Cell Biology 2022Quote: ... washed in ice-cold PBS and lysed in room temperature NP40 lysis buffer (50 mM Tris pH 7.4, 140 mM NaCl, 3 Na3VO4, 1% v/v IGEPAL CA-360 (Sigma, #I8896), Phosphatase Inhibitor cocktail (PhosStop ...
-
bioRxiv - Cell Biology 2022Quote: ... The selected elution fractions (1-3 of 500 μL each) were pooled and subsequently concentrated using 100-kDa Amicon centrifugal filter units (Merck Millipore). The concentrated samples were subjected to several washing steps with PBS to obtain a highly pure EV population ...
-
bioRxiv - Bioengineering 2022Quote: ... a 6 well plate was seeded with HEK293Ta cells at a seeding density of 3×105 cells in DMEM supplemented with 8mg/ml Polybrene (Sigma). Each well was then transduced with either 5μl ...
-
bioRxiv - Biochemistry 2022Quote: ... Blots were washed an additional three time with TBS-T and one time with TBS before 3 minute exposure with ECL HRP substrate (Millipore) and imaged on a BioRad ChemiDoc system ...
-
bioRxiv - Bioengineering 2022Quote: ... and dried under compressed air before coating one slide surface with a layer of 3-(trimethoxysilyl)propyl methacrylate (440159, Sigma) and acetic acid in deionized (DI ...
-
bioRxiv - Bioengineering 2022Quote: ... the cells were kept at dim light (2-3 μE) for 16 h and plated on fresh TAP plates containing 10 μg/mL Paramomycin (Sigma). Plates were incubated for 10 d at 30-50 μE constant light ...
-
bioRxiv - Bioengineering 2022Quote: ... with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...