Labshake search
Citations for Millipore Sigma :
8601 - 8650 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... rASRA was then concentrated and buffer-exchanged into PBS via an Amicon Ultra-15 Centrifugal Filter with a 3 kDa cut-off (cat#UFC900324, Millipore). rASRA was subjected to sterile filtration utilizing a COSTAR 0.22 µm Spin-X Centrifuge Tube Filter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Penicillin/Streptomycin, LIF and 2i (3 μM Gsk3 inhibitor CT-99021, 1 μM MEK inhibitor PD0325901) and Vitamin C (Sigma) at a final concentration of 100 μg/mL ...
-
bioRxiv - Pathology 2023Quote: Mouse epidydimal adipose tissue was harvested and digested in Hanks’ Balanced Salt Solution (HBSS, no calcium and magnesium) containing fetal bovine serum (FBS,3%) and collagenase D (2.5 mg/ml, Sigma-Aldrich) for 30 minutes at 37°C under agitation ...
-
bioRxiv - Neuroscience 2023Quote: Cells were fixed in 4% paraformaldehyde and permeabilized/blocked using PBS with 3% goat or donkey serum and 0.2% triton X-100 (Sigma Aldrich). Cells were incubated at 4°C overnight with primary antibodies against the following targets ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviruses were generated by transfecting 3 x 106 HEK-293T cells in antibiotic-free medium with 6 µg of total DNA in a 1:2:3 ratio of pMD2.G:psPAX2:transfer plasmid using polyethylenimine (PEI) (Sigma-Aldrich). 48 h after transfection ...
-
bioRxiv - Microbiology 2023Quote: The synthetic positive control had the sequence: 5’ – TCCTAAAGCACCACGCAGCATCTATCGCGAGCTTAATCACCATGCCGCGTCCAACGCGATCCCCGCTCGGCAGGGATC CCTCTTCTCGCACCGGGCCACAATCCACTGGGGTCGCTATGA – 3’ and was synthesised as an ssDNA oligo (Sigma-Aldrich). The synthesised IS2404 synthetic positive was resuspended in nuclease-free water and diluted to 0.001 pM ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 5 minutes followed by 3 washes in 40mM Tris buffer (pH=7.2) and then 1:20 Giemsa solution (Sigma-Aldrich). The blood and bone marrow were then imaged on a Zeiss Axio Imager.A2 and Zen Blue software (version 3.1).
-
bioRxiv - Microbiology 2023Quote: ... All intracellular metabolite samples were resuspended in 750μL deuterium oxide containing 1mM 3-(Trimethylsilyl)-1-propanesulfonic acid sodium salt (DSS) (178837, Sigma Aldrich) and 50mM NaIO4 (769517 ...
-
bioRxiv - Microbiology 2023Quote: ... the blots were washed again using TBST and developed using AP-reactive Nitrobluetetrazolium (NBT) 5-bromo-4-chloro-3-indolylphosphate (BCIP) tablets (Sigma). A final image of the blots was taken on a Bio-Rad ChemiDoc gel imaging system using colorimetric detection.
-
bioRxiv - Microbiology 2023Quote: ... 10 mM EDTA) with 0.5 mg/mL lysozyme and 3 mg/mL proteinase K (Sigma-Aldrich Corp., St. Louis, MO). Resultant genomic DNA was treated with RNase A and prepared for sequencing using the Nextera XT kit (Illumina Corp. ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were fixed with 3.7% formaldehyde in PBS for 20 min and permeabilized and blocked with PBS containing 0.3% Triton X-100 and 3% BSA (Sigma-Aldrich) for 1 h at room temperature and then incubated with primary antibodies to Occludin (1:50 dilution) ...
-
bioRxiv - Immunology 2023Quote: ... The samples were acidified the next day using formic acid to bring pH<3 to stop the trypsin activity and were processed through Zip-Tip using C18 tips (Millipore) to clean-up and concentrate the peptides before going through mass spec analysis.
-
bioRxiv - Microbiology 2023Quote: ... and the metal-loaded polymer purified and washed in C-buffer using an Amicon Ultra-0.5 centrifugal filter unit with 3 kDa cutoff (Millipore-Sigma). At the same time ...
-
bioRxiv - Genomics 2023Quote: ... with 3 mL of cell culture media added to each well and treated with 5 µM 5-azacytidine (A2385, Sigma), 10 µM dexamethasone (D1756 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Penicillin, Streptomycin, LIF and 2i (3 μM Gsk3 inhibitor CT-99021, 1 μM MEK inhibitor PD0325901) and Vitamin C (Sigma) at a final concentration of 100 μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... (phenylmethylsulfonyl fluoride, PMSF 1mM; 1-chloro-3-tosylamido-4-phenyl-2-butanone, TPCK, 10 μg/ml; aprotinin, 10 μg/ml Sigma) incubated for 30min on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were cultured in 0.4 μm or 3.0 μm pored Transwell inserts and fluorescein isothiocyanate (FITC)-conjugated dextran molecules of 3–5 kDa or 150 kDa (Sigma) were added at 0.5 mg/ml to the top chamber of the Transwell inserts as we previously described41 ...
-
bioRxiv - Cell Biology 2023Quote: ... blots were again washed 3 times (5 min per wash in Tween-20 saline) before addition of ECL (Millipore, MA) for chemiluminescent detection on a BioRad Image Analyzer using Image Lab to capture and quantify signal intensity ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were incubated for 3 hours in serum-free MEM containing 150 µg/mL N-ethyl-N-nitrosourea (ENU) (Sigma). Cells were then maintained in ENU-free medium for 9 days to allow mutations to establish and existing HPRT to degrade ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... collected on a fine nylon mesh and transferred to a well of a 12-well cell culture plate containing 3 mL of 1% sodium dodecyl sulfate (SDS, Sigma) to facilitate egg dispersion ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell suspensions (some of which were pooled from tumors harvested from 2-3 mice) were stimulated for 5 h with PMA (5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Microbiology 2023Quote: ... at 1:1000 dilution at room temperature for 1 hour followed by washes x 3 then staining with goat anti-rabbit HRP-conjugated antibody (Catalog #204903, Sigma) at 1:5,000 dilution at room temperature for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... The activity of trypsin was inhibited by dropping the pH to 2-3 by the addition of 10% trifluoroacetic acid (TFA, Sigma). The samples were loaded on Evosep tips to separate the digested peptides using nanoflow reversed-phase chromatography with an Evosep One liquid chromatography (LC ...
-
bioRxiv - Genetics 2024Quote: ... 29 Starved HAP1 cells were washed twice with DPBS supplemented with 1% v/v Phosphatase Inhibitor Cocktail 3 (Sigma #P0044) before trypsinization with trypLE (trypLE ...
-
bioRxiv - Cell Biology 2024Quote: ... the coverslips were washed 3 times for 5 min with PBST and mounted on microscope slides using Mowiol (EMD Millipore) as the mounting agent ...
-
bioRxiv - Pathology 2024Quote: ... 10 and 14 wounds were sectioned through the wound beyond the midpoint and wound centres identified by staining with Haematoxylin (Gills No.3) and Eosin (Sigma). All CWs were bisected.
-
bioRxiv - Cell Biology 2024Quote: ... Moreover, a non-targeting control siRNA (NT siRNA, or siCON) with the sequence 5’-CGUACUGCUUGCGAUACGGUU-3’ was used (Sigma-Aldrich). Cells were transfected with 22 pmol of siRNA oligonucleotides/well using Lipofectamine RNAiMAX (ThermoFisher Scientifc ...
-
bioRxiv - Neuroscience 2024Quote: ... for 5 minutes and washed 3-4 times in PBS before being mounted in Mowiol mounting media (Millipore, 475904-M).
-
bioRxiv - Immunology 2024Quote: ... The migrated neutrophils in the apical compartment were lysed with 0.5% Triton X-100 and neutrophil MPO activity was quantified using a colorimetric assay using citrate buffered 2,2’-azino-bis(3-ethylbenxothiazoline-6-sulfonic acid) diammonium salt (ABTS) solution (Sigma-Aldrich). After 10 min of incubation ...
-
bioRxiv - Cancer Biology 2024Quote: ... We washed the slides for 5 min in 2× SSC/0.1% IGEPAL at RT followed by a 3-minutes wash at 60 °C in 0.4× SSC/0.3% IGEPAL (Sigma-Aldrich Inc.), and an additional 3-minutes wash in 2× SSC/0.1% IGEPAL at RT ...
-
bioRxiv - Microbiology 2024Quote: ... mice were intranasally administered with 3 µg of the RSP protein and 5 μg of cholera toxin (CT; Sigma-Aldrich) as immunological adjuvant ...
-
bioRxiv - Bioengineering 2024Quote: ... or 3-5×105 pelleted cells were lysed in TRI Reagent (“LS” for fluid EV samples, conventional for cells, Merck Millipore). Liquid chloroform was added to the lysates at a 1:5 v/v ratio and vigorously mixed for 30 s ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell pellets were suspended and incubated for 3 min in 350 µl PBS mixed with 150 µl 0.4% trypan blue solution (Millipore Sigma). For determining viability ...
-
bioRxiv - Neuroscience 2024Quote: ... Larvae were anesthetized with 0.2 mg/mL ethyl-3-aminobenzoic acid ethyl ester (MESAB, Sigma-Aldrich E10521, St. Louis, MO) and mounted laterally in 2% low-melting temperature agarose (Thermo Fisher Scientific 16520) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 days post-fertilization (dpf) larvae were anesthetized in E3 medium containing 0.2 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich) and maintained at 28.5 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was injected into the fourth ventricle at a final concentration of 1-3 µg/µl in addition to trace amounts of fast-green dye (Sigma). Three 50ms square waveform electrical pulses at 5V (E2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Anatomical images were acquired from fish anesthetized with 0.2 mg/ml ethyl-3-aminobenzoic acid ethyl ester (MESAB, catalog # E10521, Sigma-Aldrich). To activate TRPV1-expressing Purkinje cells ...
-
bioRxiv - Neuroscience 2024Quote: ... in primary neuronal lysate after Aβ or gAβ treatment from mouse or human brain were quantified by the Glycerol-3-Phosphate Assay Kit (Sigma), High Sensitivity DHAP Fluorometric Assay Kit (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: Larvae were anesthetized in 0.2 mg/mL ethyl-3-aminobenzoic acid ethyl ester (MESAB, Sigma-Aldrich E10521, St. Louis, MO) prior to imaging ...
-
bioRxiv - Plant Biology 2024Quote: ... spores were sown directly on plates supplemented with Indole-3-acetic acid (IAA; Alfa aeser) or 1-Naphthaleneacetic Acid (NAA, Sigma). Size measurements were done when plants reached sexual maturity (±6/7 days) ...
-
bioRxiv - Bioengineering 2024Quote: ... Total RNA was extracted from the central body cells of 3-week-old WT and Col5a1+/− menisci by homogenizing freshly dissected tissues in TRI-reagent (T9424, Sigma) and phase-separated in 1-bromo-3-chloropropane (B9673 ...
-
bioRxiv - Neuroscience 2024Quote: ... Retinas were then washed in 1x PBS for 3×30 minutes at RT and mounted using Fluoromount aqueous mounting medium (Sigma).
-
bioRxiv - Cancer Biology 2024Quote: ... each coverslip was washed with PBS 3 times each for 5 minutes and nuclei were stained with Hoechst (Merck Sigma, Burlington ...
-
bioRxiv - Biophysics 2024Quote: ... The PDMS scaffold surface was activated by oxygen plasma and then treated with a 5% (3-aminopropyl) triethoxysilane (Sigma-Aldrich) solution in methanol for 45 min ...
-
bioRxiv - Cell Biology 2024Quote: ... After the last EtOH wash the coverslips were incubated with methanol containing 5% acetic acid and 1% (3-Aminopropyl)triethoxysilane (Millipore-Sigma) overnight in a vacuum desiccation chamber in the dark ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then collected by centrifugation and washed with 3% FBS in PBS followed by PI (Millipore Sigma, catalog P4170) staining (25 μg/mL PI ...
-
bioRxiv - Cancer Biology 2024Quote: HSJD-DIPG007 neurospheres were collected by centrifugation at 800 rpm for 3 min and dissociated into single cells with 1 mL Accutase (Sigma) for 5-10 minutes with occasional pipetting ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.3% Triton X-100 (PBST)) for 10 minutes and blocked for 1 hour with 10% normal donkey serum (Merck Millipore), 1% bovine serum albumin (BSA ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were then washed x3 in 0.24M phosphate buffer solution (PB)(Table 3) and left overnight in 0.12PB with 15% Sucrose (Sigma, 84100-1KG) at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... Each extract was resuspended in 170 µL of 100% methanol containing isotopically labeled internal standards (5-50 µM of 13C,15N Cell Free Amino Acid Mixture, #767964, Sigma; 1 ug/mL 2-amino-3-bromo-5-methylbenzoic acid, ABMBA, #R435902, Sigma) and centrifuge-filtered (0.22 µm hydrophilic PVDF membrane ...