Labshake search
Citations for Millipore Sigma :
6601 - 6650 of 10000+ citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM aniline dimer solution was freshly prepared by dissolving 5.5 mg of N-phenyl-p-phenylenediamine (Sigma-Aldrich, 241393) in 10 mL of Tyrode’s solution ∼20 h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: Fresh tumor-free lung tissue was filled with a 3% (w/v) low melting agarose preparation media (Sigma, A9414-100G). Agarose filling was performed via a catheter inserted through one or several identified bronchi ...
-
bioRxiv - Bioengineering 2023Quote: ... MSCs were frozen at passage 3 with 1.25×106 cells/ml in freezing medium containing fetal bovine serum (FBS BCBV7611, Sigma-Aldrich) with 10% dimethylsulfoxide (DMSO ...
-
bioRxiv - Bioengineering 2023Quote: ... the dermis construct was consolidated in a solution composed of 3% (w/v) calcium chloride (Calcium Chloride, Sigma Aldrich, C5670) and Thrombin at a concentration of 10 U/mL (Thrombin from bovine plasma ...
-
bioRxiv - Biochemistry 2022Quote: ... The final solution was washed 3 times with 1X PBS using an Amicon Ultra 30 kDa MW cutoff centrifugal filter (#UFC903024, Millipore) to remove unreacted PMSF and then resuspended to 200 µL (same volume as original sample) ...
-
bioRxiv - Cell Biology 2022Quote: Activation of the Cre recombinase was induced in controls and the various Knockouts mice by daily intraperitoneal (i.p.) injections of 3 mg/kg/day of tamoxifen (TMX, Sigma T5648) for 5 consecutive days ...
-
bioRxiv - Biophysics 2023Quote: ... a 10−3 M stock solution of TPPS4 was prepared by dissolving the powder (Sigma Aldrich, St. Louis, Missouri, USA) in distilled water ...
-
bioRxiv - Genetics 2022Quote: ... cells were grown in a basal erythroid medium (BEM) supplemented with hSCF, IL-3, EPO (Eprex, Janssen-Cilag) and hydrocortisone (Sigma). From day 6 to 20 ...
-
bioRxiv - Genomics 2023Quote: ... Frozen cells were thawed and added to a Dounce homogenizer containing 1 mL of nuclei isolation buffer (NIB: 10 mM TrisHCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% Igepal (Millipore Sigma #18896), and 1 x protease inhibitors (Millipore Sigma #118735800001)) ...
-
bioRxiv - Immunology 2023Quote: ... Mice were maintained on a purified diet (‘AhR-poor diet’, AIN-93M, Safe diets) supplemented or not in Indole-3-carbinol (I3C, 200 ppm, Sigma). In some experiments ...
-
bioRxiv - Developmental Biology 2023Quote: ... The growth medium of organoids was supplemented with 100μM with 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (8-Br-cAMP) (Sigma, #B7880) in iPSC organoids or 200μM forskolin (FSK ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cumulus oocyte complexes were collected by tearing the ampulla wall of the oviduct, placed in Ferticult medium (FertiPro N.V, Belgium) supplemented with 3 % BSA (Sigma–Aldrich), and maintained at 37°C under 5 % CO2 in air under mineral oil (FertiPro N.V ...
-
bioRxiv - Microbiology 2023Quote: ... Protein was then eluted off the agarose by resuspension in 100 µL of 3X FLAG elution buffer (3 µL of 5 mg/mL Sigma 3X FLAG peptide solution + 97 µL of coIP buffer 2 ...
-
bioRxiv - Immunology 2023Quote: ... ex vivo isolated naïve or overnight stimulated (anti-CD40 at 5μg/ml and IL-4 at 1ng/ml) 3×105 B cells were plated on a poly-D lysine (PDL) (Sigma)-coated XF96 cell culture microplate and incubated at 37 °C for a minimum of 30 min in a CO2-free incubator in assay medium (XF RPMI medium pH 7.40 supplemented with 2 mM L-glutamine ...
-
bioRxiv - Plant Biology 2023Quote: ... The 30 collected fractions were combined into 15 pools and desalted on C18 Cartridges (Empore SPE Cartridges C18 standard density, bed I.D. 7 mm, volume 3 ml, Sigma-Aldrich). Each fraction was concentrated by vacuum centrifugation and reconstituted in 40 µl of 0.1% (v/v ...
-
bioRxiv - Microbiology 2023Quote: MDCK cells (2 x 105 cells) were cultured on polycarbonate Millicell culture plate inserts (12- mm diameter, 3-µm pore size; Merck Millipore) at 37°C under 5% CO2 atmosphere.
-
bioRxiv - Cell Biology 2023Quote: Lipid overlay assay PI strips were blocked in PBST (0.1% Tween 20 [v/v]) supplemented with 3% (w/v) fatty acid-free BSA (Sigma-Aldrich) overnight at 4°C and then incubated with 0.5 μg/ml GST fusion proteins for 1 h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... diluted to 20 µg mL-1 in 10 mM Tris-SO4 (pH 7.5) and 250 mM sucrose and supplemented with 3 µM horse heart cytochrome c (Sigma Aldrich). For measurement of NADH:O2 oxidoreduction ...
-
bioRxiv - Bioengineering 2023Quote: iLPC organoids formed after 48 hours post-seeding were fixed for 3 hours in 4% paraformaldehyde (PFA) in phosphate buffered saline (PBS) (Sigma), before a double-embedding process in 1.5% agarose gel then paraffin as described previously [13 ...
-
bioRxiv - Cell Biology 2023Quote: ... The calvarias were shredded to 1 mm × 1 mm pieces and digested for 30 min at 37 °C in Dulbecco’s modifiation of Eagle’s medium (DMEM, Gibico, USA) with 3 mg/ml collagenase I (Sigma-Aldrich, Germany) and 0.25% trypsin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were again washed 3 × 5 min with PBS + 0.1% Tween 20 and incubated with Classico/Crescendo Western HRP substrate (Millipore-Sigma) for 2 min ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
The aryl hydrocarbon receptor in β-cells mediates the effects of TCDD on glucose homeostasis in micebioRxiv - Molecular Biology 2023Quote: ... n = 3 – 9 mice / group) were transferred to a 1.5 mL microcentrifuge tube and washed with pre-warmed PBS+/+ (Sigma, # D8662). Islets were dispersed by adding 400 µl Accutase (VWR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Preparative scale reactions were carried out in 3 mL Slide-A-Lyzer cassettes (10 kDa MWCO, Merck Millipore, Darmstadt, Germany) in combination with custom-made FM containers57 ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were eluted with 100 µL of elution buffer supplemented with 200 µg/mL 3× Flag-peptide (Sigma-Aldrich, #F4799) and stored at -80◦C until usage ...
-
bioRxiv - Molecular Biology 2023Quote: ... and dialyzed against cold sterile PBS using an Amicon Ultra-15 Centrifugal Filter Unit with a 3 kDa MWCO (Merck Millipore). The resulting product was then passed through a 0.22 µM filter.
-
bioRxiv - Cell Biology 2023Quote: ... In vitro excision of Nr3c1 exon 3 was achieved by treating primary myoblasts with 4-OH-tamoxifen (Sigma Aldrich, H7904).
-
bioRxiv - Bioengineering 2023Quote: ... and 5 μm sections were taken before being baked for 3 hours at 60°C and stained with hematoxylin and eosin (H&E, Sigma) or Masson’s trichrome (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 – 6 mg of cell extract and 20 μl of α-Flag M2 affinity bead suspension (Sigma, catalog no.: A2220) were used ...
-
bioRxiv - Immunology 2023Quote: ... BMDMs were primed with 100 ng/mL LPS for 3 hours followed by 2.5 mM ATP treatment or 5h 10uM IKKi (BMS-345541, Sigma-Aldrich) treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were washed again with PBS to remove residual detergent and then blocked in 3% bovine serum albumin (BSA) (Sigma) in PBS for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... in PBS at +4⁰C in the shaker and then 3-4 min with a pancreatin-trypsin (2.5 mg/ml pancreatin [P3292; Sigma Aldrich] and 22.5 mg/ml trypsin dissolved in Thyrode’s solution pH 7.4 ...
-
bioRxiv - Genomics 2023Quote: ... Expression of the Dam-POI in the mouse ESC lines was suppressed by addition of 0.5 mM indole-3-acetic acid (IAA; Sigma, I5148).
-
bioRxiv - Cell Biology 2023Quote: Adult zebrafish at the appropriate age were deeply anesthetized with 0.01% ethyl 3-aminobenzoate methane sulfonate (Tricaine, MS-222, Sigma Aldrich) and sacrificed by decapitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Eluted fractions were concentrated and dialyzed against PBS using Amicon Ultra-15 Centrifugal Filter Units with a 3 kDa MWCO (Merck Millipore). Endotoxins were removed using High Capacity Endotoxin Removal Spin Columns (Pierce) ...
-
bioRxiv - Pathology 2023Quote: Mouse epidydimal adipose tissue was harvested and digested in Hanks’ Balanced Salt Solution (HBSS, no calcium and magnesium) containing fetal bovine serum (FBS,3%) and collagenase D (2.5 mg/ml, Sigma-Aldrich) for 30 minutes at 37°C under agitation ...
-
bioRxiv - Neuroscience 2023Quote: Cells were fixed in 4% paraformaldehyde and permeabilized/blocked using PBS with 3% goat or donkey serum and 0.2% triton X-100 (Sigma Aldrich). Cells were incubated at 4°C overnight with primary antibodies against the following targets ...
-
bioRxiv - Microbiology 2023Quote: The synthetic positive control had the sequence: 5’ – TCCTAAAGCACCACGCAGCATCTATCGCGAGCTTAATCACCATGCCGCGTCCAACGCGATCCCCGCTCGGCAGGGATC CCTCTTCTCGCACCGGGCCACAATCCACTGGGGTCGCTATGA – 3’ and was synthesised as an ssDNA oligo (Sigma-Aldrich). The synthesised IS2404 synthetic positive was resuspended in nuclease-free water and diluted to 0.001 pM ...
-
bioRxiv - Microbiology 2023Quote: ... the blots were washed again using TBST and developed using AP-reactive Nitrobluetetrazolium (NBT) 5-bromo-4-chloro-3-indolylphosphate (BCIP) tablets (Sigma). A final image of the blots was taken on a Bio-Rad ChemiDoc gel imaging system using colorimetric detection.
-
bioRxiv - Microbiology 2023Quote: ... 10 mM EDTA) with 0.5 mg/mL lysozyme and 3 mg/mL proteinase K (Sigma-Aldrich Corp., St. Louis, MO). Resultant genomic DNA was treated with RNase A and prepared for sequencing using the Nextera XT kit (Illumina Corp. ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were fixed with 3.7% formaldehyde in PBS for 20 min and permeabilized and blocked with PBS containing 0.3% Triton X-100 and 3% BSA (Sigma-Aldrich) for 1 h at room temperature and then incubated with primary antibodies to Occludin (1:50 dilution) ...
-
bioRxiv - Immunology 2023Quote: ... The samples were acidified the next day using formic acid to bring pH<3 to stop the trypsin activity and were processed through Zip-Tip using C18 tips (Millipore) to clean-up and concentrate the peptides before going through mass spec analysis.
-
bioRxiv - Microbiology 2023Quote: ... and the metal-loaded polymer purified and washed in C-buffer using an Amicon Ultra-0.5 centrifugal filter unit with 3 kDa cutoff (Millipore-Sigma). At the same time ...
-
bioRxiv - Genomics 2023Quote: ... with 3 mL of cell culture media added to each well and treated with 5 µM 5-azacytidine (A2385, Sigma), 10 µM dexamethasone (D1756 ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were cultured in 0.4 μm or 3.0 μm pored Transwell inserts and fluorescein isothiocyanate (FITC)-conjugated dextran molecules of 3–5 kDa or 150 kDa (Sigma) were added at 0.5 mg/ml to the top chamber of the Transwell inserts as we previously described41 ...
-
bioRxiv - Cell Biology 2023Quote: ... blots were again washed 3 times (5 min per wash in Tween-20 saline) before addition of ECL (Millipore, MA) for chemiluminescent detection on a BioRad Image Analyzer using Image Lab to capture and quantify signal intensity ...
-
bioRxiv - Neuroscience 2024Quote: ... in primary neuronal lysate after Aβ or gAβ treatment from mouse or human brain were quantified by the Glycerol-3-Phosphate Assay Kit (Sigma), High Sensitivity DHAP Fluorometric Assay Kit (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: Larvae were anesthetized in 0.2 mg/mL ethyl-3-aminobenzoic acid ethyl ester (MESAB, Sigma-Aldrich E10521, St. Louis, MO) prior to imaging ...
-
bioRxiv - Bioengineering 2024Quote: ... Total RNA was extracted from the central body cells of 3-week-old WT and Col5a1+/− menisci by homogenizing freshly dissected tissues in TRI-reagent (T9424, Sigma) and phase-separated in 1-bromo-3-chloropropane (B9673 ...
-
bioRxiv - Neuroscience 2024Quote: ... Retinas were then washed in 1x PBS for 3×30 minutes at RT and mounted using Fluoromount aqueous mounting medium (Sigma).