Labshake search
Citations for Millipore Sigma :
6451 - 6500 of 10000+ citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: ... The bound peptides were eluted 3 times from the beads with 0.1% trifluoroacetic acid (TFA; Sigma-Aldrich, Saint Louis, USA). The eluted fractions were pooled together and vacuum-dried ...
-
bioRxiv - Cell Biology 2021Quote: ... the bound proteins were eluted by incubation with 250 μl of 3 x FLAG peptide solution (200 μg/mL) (Sigma) for 15-20 min twice ...
-
bioRxiv - Cell Biology 2020Quote: ... lysed using cold EZ lysis buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2 and 0.1% IGEPAL CA-630, Sigma-Aldrich, UK), transferred to chilled nuclease-free tubes ...
-
bioRxiv - Genomics 2021Quote: ... Expression of the Dam-POI constructs was suppressed by addition of 0.5 mM indole-3-acetic acid (IAA; Sigma, I5148). Lines were tested routinely for mycoplasma.
-
bioRxiv - Microbiology 2021Quote: ... 10 mM EDTA) with 0.5 mg/mL lysozyme and 3 mg/mL proteinase K (Sigma-Aldrich Corp., St. Louis, MO). DNA was purified using the PureLink Genomic DNA Mini kit (Thermo Fisher Corp. ...
-
bioRxiv - Physiology 2021Quote: ... The preparation was bathed in standard locust saline (in mM: 147 NaCl, 10 KCl, 4 CaCl2, 3 NaOH and 10 HEPES buffer; pH = 7.2; chemicals from Sigma-Aldrich).
-
bioRxiv - Cell Biology 2021Quote: ... Auxin-inducible degron (AID)-tagged strains were constructed as described (Snyder et al., 2019) and freshly prepared 10,000x stocks (500 mM) 3-indole acetic acid (IAA) (Sigma Aldrich) dissolved in 100% ethanol were used to treat yeast cultures (YPD ...
-
REV-ERBα mediates complement expression and circadian regulation of microglial synaptic phagocytosisbioRxiv - Neuroscience 2020Quote: ... blocked for 30 mins in TBS containing 3% goat serum and 0.25% Triton X-100 (Sigma-Aldrich, St. Louis, MO) then incubated in TBS containing 1% goat serum and 0.25% Triton X-100 with primary antibody overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The beads were then washed three times with lysis buffer #1 and incubated with gentle rotation for 30 min at 4°C with 50 μL of an elution buffer (50 mM HEPES-KOH, pH7.2, 150 mM NaCl, 500 μg/mL 3×FLAG peptide [Sigma-Aldrich]). The final supernatant containing 3×FLAG-TBC1D18 was transferred to a fresh tube.
-
bioRxiv - Biochemistry 2021Quote: ... 2-3 mg of sNASP-FLAG-myc and sNASP-Strep-HA extracts were incubated for 3 hours at 4 °C degrees with 50 μl of anti-Flag M2 (A2220, Sigma) or Anti-TwinStrep Mag-Strep beads (2-4090-002 ...
-
bioRxiv - Biochemistry 2021Quote: ... Fractions containing eluted BfNFeoAB were concentrated at 4°C using a 15 mL Amicon 3 kDa molecular-weight cutoff (MWCO) spin concentrator (Millipore). Concentrated protein was then further purified by size exclusion chromatography (SEC ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA fragment containing the entire protein encoding ORF of PSMA5 was amplified with a forward primer containing a EcoRI site (5’-TTTT GAATTC ATG TTT CTT ACC CGG TCT GAG TAC GAC-3’, Sigma) and a reverse primer containing sequences specifying an FLAG tag ...
-
bioRxiv - Cell Biology 2021Quote: ... and an EcoRI site (5′-TTTT GAATTC TTA CTT ATC GTC GTC ATC CTT GTA ATC AAT GTC CTT GAT AAC CTC TTC AAG-3’, Sigma). The PCR products were digested with EcoRI restriction enzyme and cloned into the EcoRI-digested pcDNA3.1/Zeo(+ ...
-
bioRxiv - Neuroscience 2021Quote: ... Both CM as well as control CHO media was centrifuged (200g for 10 min) to remove debris and concentrated using a YM-3 column (Millipore) as described previously (Kurup et al ...
-
bioRxiv - Neuroscience 2021Quote: ... and the non-specific binding was blocked using a blocking buffer containing 3% bovine serum albumin (BSA) (Sigma-Aldrich, #A9647) in PBST (137 mM NaCl ...
-
bioRxiv - Genetics 2021Quote: Synchronized young adult animals (AD2-3) grown on RNAi bacteria at 25° were stained with 75 µg/ml acridine orange (AO)(Sigma) for 1 hour ...
-
bioRxiv - Biochemistry 2021Quote: An RNA oligonucleotide (5′ -UUUUCAUGCUACGCGUAGUUUUCUACGCG-3′; 4N) with Cyanine 5.5 at the 5′-end was obtained from Millipore Sigma (USA). The RNA scaffold was annealed in 20 mM HEPES ...
-
bioRxiv - Immunology 2020Quote: ... Sorted cells were then spun (1000 xg for 5 minutes) onto glass slides using a Shandon Cytospin 3 Cytocentrifuge (ThermoScientific) and stained with Prussian Blue and Neutral Red (Sigma). Red pulp macrophages were visualised and photographed using a Leica DM1000 light microscope (100x oil objective).
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were removed from the egg and anaesthetised in a petri dish of seawater containing 10mg/mL ethyl 3-aminobenzoate methanesulfonate salt (MS-222, Sigma) prior to microinjection according to Gillis and Hall (2016) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Eluted protein samples were combined in one tube and desalinated using an ultrafiltration tube (Amicon Ultra 3 kDa molecular weight cut-off, Merck/Millipore) with Buffer C (50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were blocked for 1 hour in 3% BSA-TBS and incubated overnight at 4°C with the following primary antibodies: anti-phosphotyrosine 4G10 (Millipore), anti-phosphorylated SYK (pY525/526 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated during the 3 days chase period with the following compounds: Bafilomycin A1 (5-10 nM; Sigma-Aldrich), Rab7 inhibitor (CID 1067700 ...
-
bioRxiv - Cell Biology 2020Quote: ... Embryos were then washed 3 x 5 min with 3% BSA in PBS-T and incubated with the following DNA dye and secondary antibody dilutions in blocking solution for 3 hours at room temperature: Hoechst 33342 (0.2 mM, Sigma-Aldrich), Goat Anti-Chicken Alexa Fluor® 647 (4 μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then treated with 6-thio-dG (3-5 μM) in the presence of 500 ng/ml doxycycline (Sigma), washed three times with warm PBS and allowed to recover in regular growth medium containing 500 ng/ml doxycycline ...
-
bioRxiv - Immunology 2020Quote: Each peptide sample was desalted on Empore SPE C18 cartridges (standard density, bed inner diameter 7 mm, volume 3 ml; Sigma), then concentrated by vacuum centrifugation and reconstituted in 40 µl 0.1% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... 5 days post fertilization (dpf) zebrafish larvae were anaesthetized with 0.017% Ethyl 3-aminobenzoate methanesulfonate (MS-222, Tricaine, Sigma-Aldrich) in egg water ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM EDTA) with 0.5 mg/mL lysozyme and 3 mg/mL proteinase K (Sigma-Aldrich Corp., St. Louis, MO). To obtain sufficient DNA from AR BANK # 0943 and AR BANK # 0958 ...
-
bioRxiv - Immunology 2021Quote: ... or 2 μM NH-3 in the presence of 10 nM T3 for 24 h before the addition of 3 μL of a fluorescent latex bead suspension (L0280, Sigma) in complete DMEM in a ~100:1 bead-to-cell ratio for 2 h before the end of the experiment ...
-
bioRxiv - Microbiology 2020Quote: ... 198 μl/well were transferred into 3 wells of a black 96-well plate with transparent flat bottom (Sigma Aldrich). Then ...
-
bioRxiv - Molecular Biology 2021Quote: Total splenocytes were isolated from C57BL/6 and mFICD-/- mouse spleens and then treated for 3 days with 20 μg/ml LPS (Sigma), 100 µg/ml heparan sulfate or 2.5 μM thapsigargin (Enzo Life Sciences) ...
-
bioRxiv - Microbiology 2021Quote: ... cells were washed with serum-free DMEM and cultured in DMEM containing 3% FBS and 1.5% sodium carboxymethyl cellulose (Sigma-Aldrich). Visible plaques were counted ...
-
bioRxiv - Microbiology 2021Quote: ... and human choriocarcinoma/trophoblastic cancer (JEG-3) cells were grown in DMEM supplemented with 10% FBS and MEM Non-essential Amino Acid Solution (Sigma). C6/36 cells were grown at 28°C in a 5% CO2 incubator ...
-
bioRxiv - Microbiology 2021Quote: ... RH TIR1-3FLAG or RH TgPDE-mAID-3HA tachyzoites cultivated in HFFs in D10 medium were treated with 0.5 mM 3-indoleacetic acid (auxin; IAA) (Sigma Aldrich) prepared in 100% ethanol (Pharmco ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL of lysis buffer (8M urea in 50mM Tris-Cl pH 7.5, supplemented with phosphatase inhibitor cocktail 3 [Millipore-Sigma]) was added to each of the pellets and pipetted up and down several time to lyse a portion of the pellet ...
-
bioRxiv - Immunology 2021Quote: ... and PBS-treated (n ≥ 3) control human gut xenografts and mouse jejunum were purified using GenElute Mammalian Total RNA kit (Sigma) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... and the colour reaction was carried out with NBT/BCIP (4-nitroblue tetrazolium chloride/bromo-4-chloro-3-indolyl phosphate; Sigma). Sections were dehydrated and mounted with Vectamount (Vector Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides containing the sequence 5’-TGCATGTTCTCACTGCTCCTTTACTAGCAAATACAACAGAAGACAAACCTAGTAA AGATGATTTTCAGACTGCCCAACTATTGGCACTTGTATTGGAATTGTTAACATTTT GTGTGGAGCACCATACCTACCACATAAAGAACTACATTATTAATAAGGATATCCT CCGGAGAGTGCTAGTTCTTATGGCCTCGAAGCATGCTTTCTTGGCATTATGTGCC CTTCGTTTTAAAAGAAAGATTATTGGATTAAAAGATGAGTTTTACAACCGCTACA TAATGAAAAGTTTTTTGTTTGAACCAGTAGTGAAAGCATTTCTCAACAATGGATC CCGCTACAATCTGATGAACTCTGCCATAATAGAGATGTTTGAATTTATTAGAGTG GAAGATATAAAATCATTAACTGCTCATGTAATTGAAAATTACTGGAAAGCACTG GAAGATG-3’ were used (Mission esiRNA, Sigma) and transfected into cells using Lipofectamine 2000 reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... This formulation lacked Wnt3a and R-spondin-3 but was supplemented with EGF (50 ng/mL) along with Gastrin (10 nM, Sigma), Noggin (50 ng/mL ...
-
bioRxiv - Genomics 2021Quote: ... then permeabilized and blocked for non-specific binding in blocking buffer containing 3% normal horse serum and 0.25% Triton X-100 (Sigma X100) in a humidified chamber for 1 hr at room temperature8 ...
-
bioRxiv - Genomics 2021Quote: Sections were washed in 0.1M TBS and then non-specific binding site blocking and cell permeabilization was performed with blocking buffer containing 3% normal horse serum and 0.25% Triton X-100 (Sigma X100). Sections were incubated with primary antibody (see list below ...
-
bioRxiv - Genomics 2021Quote: Fresh nuclei were incubated for 3 minutes at 37°C with limiting concentrations of the DNA endonuclease deoxyribonuclease I (DNase I) (Sigma) in buffer A supplemented with Ca2+ ...
-
bioRxiv - Cell Biology 2021Quote: ... fresh-frozen tissue sections were fixed in 4% paraformaldehyde in HBSS overnight at 4°C and treated with 0.2 N HCl for 20 minutes and subsequently with 3 μg/ml Proteinase K (#3115887001, Sigma-Aldrich) for 7 minutes at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... The plasmids for inducible expression of the human CNBP counterpart was generated by cloning the FLAG epitope CDS fused in-frame with the 3′ end of the hCNBP CDS (CNBP-201 splice variant, CCDS 3056.1) into the UAS-attB vector (Genewiz, SIGMA-ALDRICH). The dCNBP-3HA-res or UAS-hCNBP-FLAG were injected in y1 w67c23 ...
-
bioRxiv - Cell Biology 2021Quote: ... sphere (1.5 μm – 3 μm)) coated with 8.45 mM poly(ethylene glycol)methyl ether thiol (Mn 800, Cat. No. 729108, Sigma Aldrich) solution for 2 h at room temperature were used ...
-
bioRxiv - Microbiology 2022Quote: ... and the ampicillin media was stained by adding 5 µl and 3 µl of a fluorescent dye (rhodamine, Sigma S1402) in 100ml of media used to grow MG:GT and MG/pBGT cells ...
-
bioRxiv - Neuroscience 2022Quote: ... permeabilization and blocking of non-specific binding with 0.2 % Triton-X and 3 % bovine serum albumin (BSA, A7906, Sigma Aldrich), samples were incubated overnight at 4 °C with a solution of PBS containing 0.2 % Triton-X ...
-
bioRxiv - Neuroscience 2022Quote: Larvae were anesthetized in 0.2 mg/mL ethyl-3-aminobenzoic acid ethyl ester (MESAB, Sigma-Aldrich E10521, St. Louis, MO) prior to imaging except where noted ...
-
bioRxiv - Cell Biology 2022Quote: ... and transferred to 1.5 ml Eppendorf tubes where the cells were fixed for a minimum of one hour or overnight in 3% formaldehyde (Sigma) in PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... Labelled XIAP BIR2AG124-240 was directly concentrated on 3 KDa molecular weight cut off Centricon centrifugal filter units (EMD Millipore) until 300 μL at 240 μM were obtained.
-
bioRxiv - Biophysics 2022Quote: ... The UBF solution was supplemented with 10% glycerol and concentrated in Amicon Ultra 3 MWCO (molecular weight cut-off) concentrator columns (Millipore-Sigma UFC 500396 - hereafter called Amicon concentrators) ...