Labshake search
Citations for Addgene :
4601 - 4650 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... hESCs were co-transfected with pZT-C13-L1 (Addgene, #62196) and pZT-C13-R1 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... into the pC13N-dCas9-BFP-KRAB plasmid (Addgene, #127968), containing CLYBL homology arms and a CAG promoter ...
-
bioRxiv - Cell Biology 2024Quote: ... and psPAX2 (Addgene 12260) vectors to generate viral supernatants ...
-
bioRxiv - Cell Biology 2024Quote: ... CRISPR knockout lines were generated by cloning pLentiCRISPRv2 (Addgene 98290) plasmids with sgRNA sequences targeting ODC1 or the Rosa safe harbor locus ...
-
bioRxiv - Cell Biology 2024Quote: ... and pCMV-RosaR4 KKR (Addgene #37199) with the lipofectamine 3000 transfection reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... pCSII-EF-miRFP670v1-hGem(1/110) was a gift from Vladislav Verkhusha (Addgene plasmid # 80006; http://n2t.net/addgene:80006; RRID:Addgene_80006). Supernatants containing lentiviral pseudoparticles were harvested 24 and 48 h post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... The plasmids generated in this study and those obtained from Addgene are listed in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Overlap extension PCR was then performed for Eplin α using the pEGFP-Eplinα (Addgene plasmid 40947) as template and the Eplin_F ACGAGCTGTACAAGTC-CGGACTCAGA and Eplin_R CCGGTGGATCCCGGGC primers ...
-
bioRxiv - Cell Biology 2024Quote: We used CRISPR/Cas9 Synergistic Activation Mediator (SAM) strategy to induce upregulation of NEAT1.54 Lentiviral particles were generated from Addgene plasmid #61425 having dCAS9-VP64 and plasmid #61426 containing MS2-P65-HSF ...
-
bioRxiv - Cell Biology 2024Quote: ... Myers (Addgene plasmid # 63934). The cDNA encoding the β1AR was a kind gift from Ulrike Zabel (University of Würzburg ...
-
bioRxiv - Cell Biology 2024Quote: ... or pCA-mTmG (Addgene, 60953), respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... we amplified IgK signal peptide and PDGFR transmembrane domain by PCR from the template of pcDNA3.1-kappa- myc-dL5-2xG4S-TMst (Addgene, 73206) or pCA-mTmG (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... The pU6-SacB-scRNA-Cas9-T2A-mCherry plasmid was a gift from Kim Failor (Addgene plasmid # 117070) and pFETCh_Donor (EMM0021 ...
-
bioRxiv - Cell Biology 2024Quote: ... The sgRNA sequence targeting the desired gene was cloned into either pSpCas9(BB)-2A-GFP (PX458) (Addgene) or pSpCas9(BB)-2A-Halo ...
-
bioRxiv - Cell Biology 2024Quote: ... The sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene).
-
bioRxiv - Cell Biology 2024Quote: ... [18] and pCMV 3xFLAG-LC3B Q116P G120 (Addgene plasmid # 129289 ...
-
bioRxiv - Cell Biology 2024Quote: ... pCSII-EF-miRFP670v1-hGem(1/110) was a gift from Vladislav Verkhusha (Addgene plasmid # 80006 ...
-
bioRxiv - Cell Biology 2024Quote: Plasmids used in this study were generated by our lab previously: pCMV 3xFLAG-LC3B G120 (Addgene plasmid # 123094 ...
-
bioRxiv - Cell Biology 2024Quote: ... guide5: TCGGCAAGCAGTGTAAACGG) and cloned into the pSpCas9(BB)-2A-GFP (Plasmid #48138; Addgene). FaDu cells were transfected with 500 ng of plasmid according to manufacturer’s instructions (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... The sequences of shRNA oligos were either from Sigma-Aldrich’s predesigned shRNA or from Addgene as listed in the plasmid table ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.8 µg psPAX2 plasmids(Addgene #12260), 0.7 µg pMD2.G plasmids (Addgene #12259) ...
-
bioRxiv - Cell Biology 2024Quote: shRNA coding sequences were cloned and inserted into 3rd generation transfer plasmid pLKO.1-TRC cloning vector (Addgene #10878) following the Addgene protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.7 µg pMD2.G plasmids (Addgene #12259), and 1.5 µg of transfer plasmid encoding targeted cDNA or shRNA were transfected into 1 well of cells using lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μg VSVG (gift from Bob Weinberg, Addgene #8454)(67 ...
-
bioRxiv - Cell Biology 2024Quote: ... and BFP-KDEL (#49150) plasmids were obtained from Addgene. AC-ER GFP was generated starting from the commercial vector of AC-tagGFP (ChromoTek ...
-
bioRxiv - Cancer Biology 2024Quote: ... HA-VHL-pRc/CMV (#19999, Addgene) plasmid was used to create stable cell lines ...
-
bioRxiv - Cancer Biology 2024Quote: HA-VHL wt-pBabe-puro (#19234, Addgene) plasmid was used for transient transfections ...
-
bioRxiv - Cancer Biology 2024Quote: Polyclonal knockout cell lines were generated by stable expression of Cas9 (#52962, Addgene) in target cells ...
-
bioRxiv - Cell Biology 2024Quote: ... gRNA sequences were cloned into gRNA_Cloning vector (Addgene plasmid #41824 ...
-
bioRxiv - Cancer Biology 2024Quote: The plasmids pcDNA3.1-SARS2-spike (#145032) and p-CMV-Neo-Bam-p53wt (#16434) were obtained from Addgene. The plasmids were transiently transfected with lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... These were amplified by two miR-E universal primers (fwd 5′-CTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGA CAGTGAGCG-3′) (rev 5′-ACAAGATAATTGCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGT AGGCA-3′) and cloned into the XhoI and EcoRI double digested LT3GEPIR lentiviral vector (Addgene #111177). HEK293T cells were transfected with these vectors to produce lentivirus which was then used to transduce lamin TKO mESCs ...
-
bioRxiv - Cell Biology 2024Quote: ... 5.7ug of pRSV.Rev (Addgene plasmid #12253), and 7.9ug of pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2024Quote: CLN3-GFP plasmid was obtained from Addgene (#78110), a kind gift from Dr ...
-
bioRxiv - Cell Biology 2024Quote: The pLenti6-H2B-mCherry plasmid was purchased from Addgene (89766). MDA-MB-231 and MDA-MB-468 cell lines were transduced with lentiviral plasmid vectors to create stable lines ...
-
bioRxiv - Cell Biology 2024Quote: ... For pAAVS1-Nst-MCS (Addgene #80487), an AAVS1 targeting vector containing neomycin resistant gene ...
-
bioRxiv - Cell Biology 2024Quote: ... and then integrated into the multi-cloning site of PCR-amplified linearized pAAVS1-P-CAG-mCh (Addgene plasmid #80492), an AAVS1 targeting vector containing puromycin resistant gene ...
-
bioRxiv - Cell Biology 2024Quote: ... 293FT cells were co-transfected with 1.86 μg psPAX2 (gift from Didier Trono, Addgene #12260), 1 μg VSVG (gift from Bob Weinberg ...
-
bioRxiv - Cell Biology 2024Quote: ... 22.5ug of transfer vector was combined with 14.7ug of pMDLg/pRRE (Addgene plasmid #12251), 5.7ug of pRSV.Rev (Addgene plasmid #12253) ...
-
bioRxiv - Cell Biology 2024Quote: All vectors were derived from pFUW (Addgene plasmid #14882). pFUW was linearized using NheI-HF (NEB R3131 ...
-
bioRxiv - Cell Biology 2024Quote: ... human Dynamin2 (#27689) and human AP2μ2 (#27672) were purchased from Addgene. cDNA encoding human AP2β2 (Clone ID ...
-
bioRxiv - Cell Biology 2024Quote: ... and 7.9ug of pMD2.G (Addgene plasmid #12259) in a 15mL conical tube ...
-
bioRxiv - Cell Biology 2024Quote: ... mCherry-RAB5 Q79L (35138, Addgene), FLAG-FCHSD2 (GenScript) ...
-
bioRxiv - Cell Biology 2024Quote: ... plKO.1-TetON-Puro-Hif1a 0819 (Addgene 118704).
-
bioRxiv - Cell Biology 2024Quote: The eGFP-CCDC32(FL, human) fragment in a pEGFP-C1 vector was purchased from Addgene (#110505) and then mutated to be siRNA resistant ...
-
bioRxiv - Cell Biology 2024Quote: GFP nanobody beads were prepared from vector pGEX6P1-GFP-Nanobody (Addgene #61838) as per the protocol.57 The beads were stored in 20% ethanol made in PBS as 1:1 slurry ...
-
bioRxiv - Cell Biology 2024Quote: ... viral packaging plasmid (pspax, Addgene #12260), and viral envelope plasmid (pMD2.G ...
-
bioRxiv - Cell Biology 2024Quote: ... were transfected using Lipofectamine 3000 as per manufacturer’s instructions with plasmids having Cas9 and gRNA (Addgene #97081) and a plasmid having repair template (Addgene #97088 ...
-
bioRxiv - Cell Biology 2024Quote: ... gRNAs were cloned into lenti sgRNA(MS2)_zeo (Addgene #61427) backbone using BsmBI restriction enzyme site ...
-
bioRxiv - Genetics 2024Quote: ... these four amplicons were placed into pCFJ151 (Addgene #19330) digested with AflII (New England BioLabs ...
-
bioRxiv - Genetics 2024Quote: promoter was amplified from pJA252 (Addgene #21512) using the primers P19 and P20 ...