Labshake search
Citations for Addgene :
4451 - 4500 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... we stereotaxically injected 400nl of AAV1-syn-Flex-GCaMP6f-SV40 (100833-AAV1, Addgene) into the dorsolateral striatum (from bregma ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were transfected with the plasmid of interest (mentioned in ‘Cloning of H3S10 variant plasmids’) and the lentiviral packaging plasmid pCMV-VSV-G a gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-syn-FLEX-jGCaMP8f-WPRE (162379-AAV1, Addgene, MA, USA), CAV-mCherry and CAV-PRS-Cre-V5 (PVM ...
-
bioRxiv - Neuroscience 2024Quote: ... were transduced with in-house prepared viral vectors with a AAV8 serotype construct containing pAAV.CAG.GCaMP6s.WPRE.SV40 plasmids (Addgene, 100844). The cells were transduced at 17 DIV by replacing the cell medium with fresh neuronal medium containing a viral load of 5e2 viruses/cell ...
-
bioRxiv - Neuroscience 2024Quote: rAAV2-retro-CAG-H2B-mGreenLantern (Addgene#177332) was produced at the University of Miami viral core facility at the Miami Project to Cure Paralysis ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was a kind gift from Eric Lander & David Sabatini (Addgene plasmid #50661 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-hSyn-dLight1.1 was a gift from Lin Tian (Addgene plasmid #111066; http://n2t.net/addgene:111066; RRID:Addgene_111066).
-
bioRxiv - Neuroscience 2024Quote: ... The Cre-dependent red excitatory opsin pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 in AAV9 serotype was purchased from Addgene (#124651-AAV9) with a titer of ≥5 x1012 vg/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... The plasmid pAAV-hSyn-dLight1.1 was purchased from Addgene (#111066) and packaged into AAV9 serotype in-house to a titer of 7.7 x 1012 vg/mL (protocol described below) ...
-
bioRxiv - Neuroscience 2024Quote: ... Wilson (Addgene plasmid #112865; http://n2t.net/addgene:112865; RRID:Addgene_112865). pAAV-hSyn-dLight1.1 was a gift from Lin Tian (Addgene plasmid #111066 ...
-
bioRxiv - Biochemistry 2024Quote: ... which was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17451)87 ...
-
bioRxiv - Biochemistry 2024Quote: ... pCDFDuet-MKK6-EE was a gift from Kevin Janes (Addgene plasmid # 82718 ; http://n2t.net/addgene:82718 ; RRID:Addgene_82718). The cloning sequence was inserted into a pET47b vector with an N-terminal 6-His tag ...
-
bioRxiv - Biochemistry 2024Quote: ... pcDNA3-CD14 was a gift from Doug Golenbock (Addgene plasmid # 13645 ...
-
bioRxiv - Biochemistry 2024Quote: ... hTLR4 was a gift from Ruslan Medzhitov (Addgene plasmid # 13086; http://n2t.net/addgene:13086; RRID:Addgene_13086). hMD-2_pcDNA3.1+ was purchased from Genscript (LY96_OHu26610C_pcDNA3.1(+)) ...
-
bioRxiv - Biochemistry 2024Quote: ... pcDNA3-CD14 was a gift from Doug Golenbock (Addgene plasmid # 13645 ...
-
bioRxiv - Biochemistry 2024Quote: ... pcDNA3-CD14 was a gift from Doug Golenbock (Addgene plasmid # 13645; http://n2t.net/addgene:13645; RRID:Addgene_13645). To measure NF-κB activity ...
-
bioRxiv - Biochemistry 2024Quote: ... pGL3-ELAM-luc was a gift from Doug Golenbock (Addgene plasmid # 13029; http://n2t.net/addgene:13029; RRID:Addgene_13029). pRL-TK was purchased from Promega ...
-
bioRxiv - Biochemistry 2024Quote: ... The DIvA cells were plated 24 h before experiments onto 8 well ibidi glass bottom dishes and transiently transfected with eGFP-53BP1 (Fradet-Turcotte A, 2013) (Addgene #60813) via use of Lipofectamine 3000 according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... and pCAG-Eco (Addgene plasmid #35617) and 3x (w/w ...
-
bioRxiv - Biochemistry 2024Quote: ... pCW57.1 (a gift from David Root; Addgene plasmid # 41393), or pLenti CMV Blast DEST (706-1) ...
-
bioRxiv - Biochemistry 2024Quote: ... mCherry was subcloned from H2B-mCherry (a gift from Robert Benezra; Addgene plasmid # 20972)88 into pENTR1a by flanking XhoI/XbaI sites prior to transferring to pLenti CMV Blast ...
-
bioRxiv - Biochemistry 2024Quote: ... while FLAG-HA-USP18 was a gift from Dr Wade Harper (Addgene plasmid #22572). The ISG15 E1 (UBA7 ...
-
bioRxiv - Biochemistry 2024Quote: ... His6-mISG15 and HA-mUbp43 were gifts from Dr Dong-Er Zhang (Addgene plasmid #12440 ...
-
bioRxiv - Bioengineering 2024Quote: ... psPAX2 (Addgene #12260), and pLL3.7 FLAG-YAP1-TEAD-P-H2B-mCherry (Addgene #128327 ...
-
bioRxiv - Biochemistry 2024Quote: ... pNH-TrxT was a gift from Opher Gileadi (Addgene plasmid # 26106) (Savitsky et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 μg of the plasmid encoding the Strep-tagged nucleocapsid protein was packaged with 9.183 μg of psPAX2 (Addgene #12260) and 2.768 μg of pVSV-G (Addgene #138479 ...
-
bioRxiv - Biochemistry 2024Quote: ... The tag-free wildtype (Wuhan-hu-1) nucleocapsid protein plasmid was purchased from Addgene (#177937), and the plasmid encoding the Strep-tagged nucleocapsid protein was a kind gift from Dr ...
-
bioRxiv - Biochemistry 2024Quote: ... signal amplified by PCR and inserted downstream of the tetracycline-responsive promoter between cut sites NheI and SgfI in the HP138 puro plasmid (Addgene plasmid: 134246). MORC2 constructs were amplified by PCR and inserted downstream of TetO ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... rosetta expression plasmid NK802 (Addgene; #166056)[28] replacing the mCherry sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse wild-type Pcyt2 cDNA (Horizon Discovery, MMM1013-202763346) was cloned into N174-MCS (Addgene, 81061) backbone digested with EcoRI and BamHI (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: Lentivirus was generated by co-transfection of viral vectors expressing sgRNA or cDNA of interest with packaging plasmids psPAX2 (Addgene, 12260) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: sgRNA sequences targeting Atg7 (CACCGTCTCCTACTCCAATCCCGTG), Pcyt2, (CACCGCCATGATCCGGAACGGGCA) or a non-genic region on mouse chromosome 8 (Chr8, ACATTTCTTTCCCCACTGG) were cloned into lentiCRISPRv2 (Addgene, 52961). sgRNA sequences targeting Trp53 (GAAGTCACAGCACATGACGG ...
-
bioRxiv - Plant Biology 2024Quote: ... DsRed was amplified from pAG423GAL-ccdB-DsRed (Addgene plasmid repository, plasmid #14365) using primers 5’-GGAGGAGGAGGATCGATGGACAACACCGAGGACGT-3’ and 5’-GGCCCTCTAGATCAACTACTGGGAGCCGGAGTGG-3’ ...
-
bioRxiv - Cancer Biology 2024Quote: ... VSV-G (Addgene #8454), Gag-Pol (Addgene #14887 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Gag-Pol (Addgene #14887) using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Target-sequence cassettes were assembled by first cloning the tRNA insert from plasmid pCFD6 (Addgene #73915) between long oligos containing the gRNA target sequences using Q5 polymerase (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... obtained from Addgene 45 or 500 ng 6x-FkhP with 500 ng pCS2 Flag-FOXC2 WT from Addgene 45 or mutant FOXC2 generated as described above ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells that were transfected with a plasmid alone were transfected with GFP-Mapper (Addgene 117721) or C1ORF43-FLAG (SinoBiologic ...
-
bioRxiv - Developmental Biology 2024Quote: ... Tg(dand5:EGFP) embryos were injected with bungarotoxin messenger-RNA (Addgene catalogue #69542) at the one-cell stage to immobilize them.
-
bioRxiv - Genomics 2024Quote: ... p404-BrdU-Inc (Addgene plasmid # 71790; http://n2t.net/addgene:71790; RRID:Addgene_71790) and p306-BrdU-Inc (Addgene plasmid # 71792 ...
-
bioRxiv - Genomics 2024Quote: ... pBL-TRP1-hsvTKCO-hENT1CO and pBL-AUR1C-hsvTKCO-hENT1CO plasmids are derivatives of p403-BrdU-Inc (Addgene plasmid # 71789; http://n2t.net/addgene:71789; RRID:Addgene_71789), p404-BrdU-Inc (Addgene plasmid # 71790 ...
-
bioRxiv - Cancer Biology 2024Quote: ... VSV-G (Addgene #8454) and Δ8.91 using Lipofectamine 3000 (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the 2nd generation packaging system (plasmids psPAX2, Addgene #12260 and pMD2.G, Addgene #12259) were applied to cells for 72h with polybrene (10 µg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the 2nd generation packaging system (plasmids psPAX2, Addgene #12260 and pMD2.G, Addgene #12259) were applied to cells for 72h with polybrene (10 µg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... LKB1 sgRNAs were cloned into lentiCRISPR v2 (Addgene #52961). Lentiviral particles were prepared by transfecting HEK293 cells with EV or sgLKB1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... VSV-G (Addgene #8454) and Δ8.91 using Lipofectamine 3000 (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2024Quote: sgRNAs targeting the STK11 locus were designed using CHOP-CHOP and cloned into pSpCas9(BB)-2A-GFP (Addgene #48138). KRAS-mutant NSCLC cell lines were transiently transfected with the plasmids and sorted for single clone formation by FACs ...
-
bioRxiv - Cancer Biology 2024Quote: Truncated CPSF6 containing amino acids 1-358 (CPSF6-358) from human isoform 1 was cloned into the pCW57.1 backbone (Addgene 71782). A hemagglutinin (HA ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding full-length human dynein-1 was graciously provided by the Andrew Carter Lab (Addgene plasmid 11903). This plasmid featured the dynein-1 heavy chain fused to an N-terminus for the His-ZZ-SNAPf tag ...
-
bioRxiv - Biochemistry 2024Quote: ... roseus were assembled using the GoldenBraid 2.0 kit (Sarrion-Perdigones et al., 2013) (Addgene kit # 11000000076) (Fig ...