Labshake search
Citations for Addgene :
4501 - 4550 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transfected with a mixture of 1.7 μg attB plasmid + 0.2 μg pCAG-NLS-Bxb1 (Addgene#51271) + 0.2 μg pMAX-GFP + 7.8 μL Fugene 6 (for LLP lines ...
-
bioRxiv - Molecular Biology 2024Quote: Cas9-expressing MDS-L cells were infected with lentivirus encoding the human Brunello CRISPR knockout pooled library (concentrated lentiviral aliquots were purchased from the Victorian Centre for Functional Genomics, generated from Addgene# 73178) in the presence of 8µg/mL polybrene at a multiplicity of infection of ∼0.3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... HA-FLAG-hAT1 was subcloned into pcDNA3-EGFP (plasmid #85042; Addgene) (AT1-eGFP)14.
-
bioRxiv - Genetics 2024Quote: ... we adapted a 3xP3-DsRed marker (flanked by piggyBac termini) from the pScarlessHD plasmid (a gift from Kate O’Connor-Giles, Addgene plasmid # 64703) and introduced two ∼1kb homology arms flanking the two guide RNA target sites ...
-
bioRxiv - Genomics 2024Quote: ... and hSTARR-seq_ORI vector (Addgene plasmid # 99296 ...
-
bioRxiv - Genomics 2024Quote: ... and psPAX2 (Addgene, Cat #12260) using Lipofectamine 3000 (Lifetech ...
-
bioRxiv - Immunology 2024Quote: The plasmid pRK5-myc-CDC42 obtained from Addgene encodes for the ubiquitous isoform 1 of CDC42 and contains a myc tag in N-terminal ...
-
bioRxiv - Immunology 2024Quote: ... The sequence was subcloned into an MSCV GFP vector backbone (Addgene 91975). HEK293T cells were transfected with hCD19t MSCV GFP and ampho retroviral packaging vector ...
-
bioRxiv - Immunology 2024Quote: ... 293T cells were first co-transfected with pCL-Eco and either MIGR1 (GFP control vector, kindly provided by Warren Pear, #27490 Addgene), or MIGR1-PTGIR (custom PTGIR overexpressing vector VectorBuilder) ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA-HA-14-3-3β (Addgene #13270), pcDNA-HA-14-3-3σ (Addgene #11946 ...
-
bioRxiv - Genetics 2024Quote: ... into lentiCRISPRv2 (Addgene #52961). shRNAs were cloned in an analogous manner into the pHR-SIREN-PU6-shRNA-WPRE-PPGK-Puro lentiviral vector (a gift from Paul Lehner ...
-
bioRxiv - Genetics 2024Quote: ... The resulting plasmid was transfected into HEK-239T cells along with a PX459 (Addgene #48139, kindly deposited by Feng Zhang) plasmid encoding Cas9 and an sgRNA (CTTTCTGCCCACACTAGACA ...
-
bioRxiv - Genomics 2024Quote: Plasmids hSTARR-seq_SCP1 vector (Addgene plasmid # 99292 ...
-
bioRxiv - Developmental Biology 2024Quote: Oligonucleotides zk1770A/B used to make sgRNA constructs were cloned into BsaI site of pDR274(58) (pDR274 was a gift from Keith Joung, Addgene plasmid # 42250). Cas9 mRNA was prepared using mMESSAGE mMACHINE T7 ULTRA Kit (Ambion ...
-
bioRxiv - Developmental Biology 2024Quote: ... we utilized monomeric enhanced green fluorescent protein (mEGFP) (gift from Karel Svoboda, Addgene plasmid #18696) (Harvey ...
-
bioRxiv - Developmental Biology 2024Quote: ... Individual sgRNAs targeting sites 1-4 of the SABER array were cloned into 4 separate U6x:sgRNA plasmids (Addgene plasmids 64245-64248) as described previously52 ...
-
bioRxiv - Developmental Biology 2024Quote: ... or p5E her4.3-loxP-dsRed-SV40pA-loxP together with pME-Cas9-t2A-GFP (Addgene plasmid 63155), p3E-polyA (Tol2 kit ...
-
bioRxiv - Genomics 2024Quote: ... Guides were cloned into lenti-sgRNA hygro vector (Addgene #104991) by GenScript to make the BCR-ABL sgRNA library ...
-
bioRxiv - Genomics 2024Quote: ... ABE8e SpG was made by deleting the U6 sgRNA cassette from pRDA_479 (Addgene #179099) (45 ...
-
bioRxiv - Genomics 2024Quote: Ba/F3s infected with pUltra BCR-ABL WT (Addgene #210432) were allowed to grow in the absence of IL-3 ...
-
bioRxiv - Genetics 2024Quote: ... Amplicons were cloned into a plasmid for targeting the AAVS1 safe harbor locus (AAVS1-TRE3G-EGFP was a gift from Su-Chun Zhang (Addgene plasmid # 52343; http://n2t.net/addgene:52343; RRID:Addgene_52343)) ...
-
bioRxiv - Genetics 2024Quote: ... to transfect both the AAVS1 targeting plasmids described above and transcription activator-like effector nucleases (hAAVS1 TALEN Left and Right were gifts from Su-Chun Zhang, Addgene plasmid # 52341 & 52342 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and a virus-matched transfer vector encoding GFP (pALPS-eGFP for HIV/SIV, Addgene # 101323; pQCXIP-eGFP for MLV, (22)) ...
-
bioRxiv - Evolutionary Biology 2024Quote: Single-cycle viruses were generated from three plasmids: two plasmids for transient expression of the VSV-G pseudotyping envelope protein (pMD2.G, Addgene #12259) and viral gag-pol ...
-
bioRxiv - Developmental Biology 2024Quote: ... All FAK and related phosphoresistant variants were obtain from Addgene (YFP- FAK ...
-
bioRxiv - Genomics 2024Quote: Plasmids hSTARR-seq_SCP1 vector (Addgene plasmid # 99292, RRID:Addgene_99292; listed as pTYC6 in Table S1E) and hSTARR-seq_ORI vector (Addgene plasmid # 99296 ...
-
bioRxiv - Genomics 2024Quote: ... and hSTARR-seq_ORI vector (Addgene plasmid # 99296, RRID:Addgene_99296; pTYC7 in Table S1E) were gifts from Alexander Stark [25] ...
-
bioRxiv - Genomics 2024Quote: ... pMD2.G (Addgene, Cat #12259) and psPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: ... Venus and iLID-CaaX were amplified from pLL7.0: Venus-iLID-CAAX (Addgene #60411, gift from Brian Kuhlman) and mCherry was amplified from pBI-UASp-mCherry-Cry2phr-RhoGAP71E (Herrera-Perez et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... The gRNA-encoding plasmids pU6-BbsI-chiRNA-RhoGEF2 and pU6-BbsI-chiRNA-Cysts were made by insertion of gRNA oligos into pU6-BbsI-chiRNA (Addgene #45946 ...
-
bioRxiv - Developmental Biology 2024Quote: ... pcDNA3.1-DYRK1A-V5 was generated by cloning DYRK1A from pMH-SFB-DYRK1A (Addgene cat#101770) into pcDNA3.1(- ...
-
bioRxiv - Developmental Biology 2024Quote: ... using plasmid pCS2-nCas9n(59) (pCS2-nCas9n was a gift from Wenbiao Chen, Addgene plasmid # 47929). The sgRNAs were transcribed using MEGAshortscript kit (Ambion) ...
-
bioRxiv - Immunology 2024Quote: ... pEMB52-14-3-3_1_247 (γ) was a gift from the Michael J Fox Foundation MJFF (Addgene #40541); pcDNA-HA-14-3-3β (Addgene #13270) ...
-
bioRxiv - Immunology 2024Quote: ... pCS2-HA-14-3-3ε (Addgene #116886), pCS2-HA-14-3-3ζ (Addgene #116888 ...
-
bioRxiv - Immunology 2024Quote: ... together with psPAX2 and pMD2.G (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Immunology 2024Quote: ... and pGEX-4T2-14-3-3 tau (θ) (Addgene #13281) were gifts from Michael Yaffe (Yaffe et al ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA-HA-14-3-3σ (Addgene #11946) and pGEX-4T2-14-3-3 tau (θ ...
-
bioRxiv - Immunology 2024Quote: ... pGP-CMV-GCaMP6s (GCaMP6) construct was a gift from Douglas Kim (Addgene plasmid # 40753). TCRζ-Turquoise was generated by cloning turquoise sequence in plasmid expressing TCRζ with AgeI-NotI sites ...
-
bioRxiv - Immunology 2024Quote: ... pCS2-HA-14-3-3ζ (Addgene #116888) and pCS2-HA-14-3-3η (Addgene #116887 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The U6x:sgRNAs were assembled into a contiguous sequence in the pGGDestTol2LC-4sgRNA vector (Addgene plasmid 64242) by Golden Gate ligation ...
-
bioRxiv - Developmental Biology 2024Quote: ... Plasmids will be available from Addgene.
-
bioRxiv - Systems Biology 2024Quote: ... the pCAS plasmid (Addgene #60847) was modified as previously described (Ryan et al ...
-
bioRxiv - Physiology 2024Quote: ... mutant D377Y-PCSK9 cDNA (AAV-PCSK9) was produced using the two-plasmid-method by co-transfecting AAV/D377Y-PCSK9 (gift from Jacob Bentzon; Addgene plasmid, Cat. # 58376)27 together with the helper plasmid pDP828 in HEK-293T cells using polyethylenimine (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... Weinberg (Addgene plasmid no. 1780); 4 μg of a plasmid containing the genes for Moloney murine leukaemia virus gag-pol ...
-
bioRxiv - Systems Biology 2024Quote: ... or modified lenti-Cas9-sgHPRT1 (Addgene #196713)9 ...
-
bioRxiv - Systems Biology 2024Quote: - 5.5ug PMD2G (Addgene 8454).
-
bioRxiv - Systems Biology 2024Quote: - 16.6ug PsPAX2 (Addgene 12260)
-
bioRxiv - Neuroscience 2024Quote: ... of a Cre-dependent virus encoding hM3Dq (AAV5- hSyn1-DIO- hM3Dq-mCherry, Addgene) or mCherry alone as control (AAV5-hSyn1-DIO- mCherry ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The backbone pU6-tevopreq1-GG-acceptor (Addgene #174038) was PCR amplified using the oligos SplitF and SplitR ...
-
bioRxiv - Synthetic Biology 2024Quote: ... For cloning into the backbone LentiGuide-Hygro (Addgene #139462), the library was amplified from the pU6-tevopreq1-GG-acceptor ...