Labshake search
Citations for Addgene :
4551 - 4600 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... The backbone sgBbsI (p2Tol-U6-2xBbsI-sgRNA-HygR) (Addgene #71485) was PCR amplified using the oligos BB_R and BB_F ...
-
bioRxiv - Synthetic Biology 2024Quote: ... with library plasmid amount corresponding to 1 plasmid per cell and 20 ug of base editor pCMV-T7-ABE8e-nSpCas9-P2A-EGFP (KAC978) (Addgene #185910). Genomic DNA was collected from cells 5 days after transfection.
-
bioRxiv - Synthetic Biology 2024Quote: ... with 10ug of Tol2 transposase plasmid (pCMV-Tol2 Addgene # #31823) and 10 ug of Path_Var library ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The base Cas9 CDS was amplified from ABE8e plasmid (Addgene #138489) using the oligonucleotides BE_Npu_F and BE_pJC175e_R ...
-
bioRxiv - Molecular Biology 2024Quote: ... and cloned into the lentiviral CRISPR-Cas9 delivery vector containing spCas9-eGFP under control of the EFS promoter and the sgRNA under control of the U6 promoter (Addgene). Following transfection into competent Stbl3 bacteria (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Resulting CRISPR/Cas9 lentiviral constructs were transiently transfected along with packaging plasmids pCMV-dR8.2dvpr and pCMV-VSV-G (Addgene) into HEK- 293T cells (ATCC ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was de novo synthesized based on the pYES1L-URA (Addgene plasmid #84301) plasmid and contains an additional oriV origin-of-replication for potential conditional amplification in EPI300 cells (Epicentre) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... digested and gel purified the plasmid backbone (pMPRA1, Addgene #49349) with SfiI (NEB R0123 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and bet (from pORTMAGE-363, Addgene plasmid # 72678 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The hTdT sequence was amplified from one of our previously reported plasmids (Addgene #163643)36 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the pCAG promoter was replaced with 4xHRE_YB TATA for hypoxia recording (Addgene #117399)64 or 7xTCF/LEF for Wnt recording (Addgene #12456)65 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the pCAG promoter was used (Addgene #123700 ...
-
bioRxiv - Plant Biology 2024Quote: ... the corresponding cDNA was amplified by PCR and cloned into the expression vector pDEST-HisMBP (Addgene plasmid #11085) using standard GATEWAYTM procedures ...
-
bioRxiv - Synthetic Biology 2024Quote: ... were ordered from Addgene (#87929 and #23620) and cloned into “part vectors” via Gibson assembly using Hifi DNA Assembly Master Mix according to manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2024Quote: ... and 2 µg of the envelope plasmid (pMD2.G / VSVG, Addgene #12259) per well were co-transfected using PEI ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... DRD1-TANGO or DRD5-TANGO plasmid DNA were created by Bryan Roth and obtained from Addgene (Plasmids #66268 or #66272, Addgene, Watertown, MA). The β-arrestin2 green fluorescent protein (GFP ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... plasmid DNA was originally created by Robert Lefkowitz and obtained from Addgene (plasmid #35411, Addgene, Watertown, MA;). The 22F-Glosensor plasmid was purchased from Promega ...
-
bioRxiv - Physiology 2024Quote: ... AAV-CRE (AAV8.TBG.PI.Cre.rBG) and AAV-GFP (AAV8.TBP.PI.eGFP.WPRE.bGH) were acquired from Addgene (#107787-AAV8 and #105535-AAV8). AAV-hNRF1 was produced by the University of Pennsylvania Vector Biocore and is described in our previous work48.
-
bioRxiv - Plant Biology 2024Quote: ... the CDS of AtCNIH5 was amplified by PCR and subcloned into UBQ10:sXVE: S10-(MCS) (Addgene plasmid # 108177 ...
-
bioRxiv - Plant Biology 2024Quote: ... the constructs encoding S10-tagged and S11-tagged protein fusions were co-expressed in the presence of UBQ10:sXVE: GFP1–9 (Addgene plasmid # 108187 ...
-
bioRxiv - Systems Biology 2024Quote: ... a pUC19 plasmid backbone was amplified (Addgene #50005 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1.4 µg of DRD1-TANGO or DRD5-TANGO plasmid DNA (Plasmids #66268 or #66272, Addgene, Watertown, MA) and 120 µM CaCl2 (diluted with H2O from 2 mM stock ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... DRD1-TANGO or DRD5-TANGO plasmid DNA were created by Bryan Roth and obtained from Addgene (Plasmids #66268 or #66272 ...
-
bioRxiv - Physiology 2024Quote: ... Cells were transfected with 2.5 mg of α-actinin-RFP (Addgene Cat. No: 58050). Pictures were obtained using a spinning-disk Zeiss 3i microscope at 25 frames per second for 10 seconds ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The β-arrestin2 green fluorescent protein (GFP) plasmid DNA was originally created by Robert Lefkowitz and obtained from Addgene (plasmid #35411 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Pink Flamindo was a gift from Tetsuya Kitaguchi (Addgene plasmid # 102356 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Pink Flamindo was a gift from Tetsuya Kitaguchi (Addgene plasmid # 102356; http://n2t.net/addgene:102356; RRID:Addgene_102356) [22] and PH(Akt)-Venus was a gift from Narasimhan Gautam (Addgene plasmid #85223 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... [22] and PH(Akt)-Venus was a gift from Narasimhan Gautam (Addgene plasmid #85223; http://n2t.net/addgene:85223; RRID:Addgene_85223) [23].
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Cells were transiently transfected at 80% confluence with plasmid pcDNA3 p70/S6K2 E388 D3E (#17731; Addgene; Watertown, MA; Lee-Fruman 1999) and Lipo-3000 (#L3000001 ...
-
bioRxiv - Cell Biology 2024Quote: ... pMRX-IP-GFP-LC3-RFP-LC3ΔG plasmid (Addgene plasmid # 84573) [19] was transfected according to the manufacturer’s instructions using Fugene 6 ...
-
bioRxiv - Cell Biology 2024Quote: ... pCHAC-mt-mKeima vector (Addgene plasmid # 72342) [20] was transfected following the supplier’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: The construct mCherry2-C1 was a gift from Michael Davidson (Addgene plasmid # 54563; http://n2t.net/addgene:54563; RRID:Addgene_54563), pcDNA3-AKAR4 was a gift from Jin Zhang (Addgene plasmid # 61619 ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3-AKAR4 was a gift from Jin Zhang (Addgene plasmid # 61619; http://n2t.net/addgene:61619; RRID:Addgene_61619) and pcDNA3-Lyn-AKAR4 was a gift from Jin Zhang (Addgene plasmid # 61620 ...
-
bioRxiv - Cell Biology 2024Quote: ... and pcDNA3-Lyn-AKAR4 was a gift from Jin Zhang (Addgene plasmid # 61620 ...
-
bioRxiv - Cell Biology 2024Quote: ... and pcDNA3-Lyn-AKAR4 was a gift from Jin Zhang (Addgene plasmid # 61620; http://n2t.net/addgene:61620; RRID:Addgene_61620) all above constructs were purchased from Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... 900 ng psPax2 (Addgene, 12260), and 1 μg viral plasmid were diluted in 6 μL X-tremeGENE 9 DNA transfection reagent (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: Lbr knockout was performed by lipofectamine transfection of the PX458 CRISPR/Cas9 plasmid (Addgene #48138) with one guide targeting exon 2 of Lbr (TCATAATAAAGGGAGCTCCC) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PGC-1α cDNA from pcDNA4 myc PGC-1 alpha (Addgene #10974) was cloned into the FUBW backbone driven by a ubiquitin promoter ...
-
bioRxiv - Cancer Biology 2024Quote: ... 786-O cells were transfected with PX458 plasmid (#48138, Addgene) containing RB1 targeting single guide RNAs (sgRNAs) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Flag-pRb plasmid was obtained by cloning Flag-tagged pRb into the pLVX-M-puro vector (#125839) from Addgene. For overexpression studies ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLenti-ATF4-uORF-GFP reporter plasmid was generated by placing the ATF4 5’UTR from Addgene plasmid #21850 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The GFP- shPten-shPhgdh and GFP-shPten-shRen fragments were then PCR amplified and InFusion cloned into EcoRI-linearized cEF1a-LSL-GFP (Addgene #135672) which was modified to replace the EF1α promoter with a CMV promoter by InFusion cloning ...
-
bioRxiv - Cancer Biology 2024Quote: ... Stably transfected cells were created using huAAVS1-TALENL (Addgene #59025) and huAAVS1-TALENR (Addgene #59026) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and huAAVS1-TALENR (Addgene #59026), along with donor plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... HA-Ub plasmid (Addgene, Watertown ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR product was further cloned into pGEX-4T-1 (Addgene) in-frame with the N-terminal GST-tagged fusion construct(21) ...
-
bioRxiv - Cell Biology 2024Quote: ... with the pSpCas9(BB)-2A-GFP (PX458) vector (Ran et al., 2013) (648138, Addgene, Watertown, MA) bearing the appropriate targeting sequence:
-
bioRxiv - Cell Biology 2024Quote: ... we co-transfected pB31-H3-SNAP-3xHA plasmids with the pCAGGS-FlpE Vector (Addgene #20733) using Nucleofector Kit 2 (Amaxa ...
-
bioRxiv - Cell Biology 2024Quote: ... pCMV-RosaL6 ELD (Addgene #37198), and pCMV-RosaR4 KKR (Addgene #37199 ...
-
bioRxiv - Cell Biology 2024Quote: ... 293T cells were transfected with PEI with the targeting plasmid and pMD2 (Addgene 12259) and psPAX2 (Addgene 12260 ...