Labshake search
Citations for Addgene :
4401 - 4450 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: Lentiviral viral vector for dCas9-p300 (pHR_TRE3G-p300-dCas9-P2A-mCherry, Addgene: 138456), dCas9-VP64 (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: Lentiviral vectors were produced by transfection of HEK 293T cells with the envelope (psPAX2, Addgene #12260), packaging (pMD2.G ...
-
bioRxiv - Molecular Biology 2024Quote: ... dCas9-VP64 (Addgene: 61422) and dCas9-Krab (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... The mutagenesis plasmid (MP6 – Addgene #69669) provides increased mutagenesis rates by expressing proteins involved in mismatch repair (ugi and SeqA),
-
bioRxiv - Molecular Biology 2024Quote: ... 2020] and the hSTARR-seq_ORI vector (Addgene, 99296; [Muerdter et al, 2018]). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 μg pMD2.G (Addgene, 12259) using PolyFect (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Designed epegRNA coding sequences were ordered as gBlocks (Integrated DNA Technologies) and subcloned into the pU6 pegRNA GG acceptor plasmid (Addgene #132777) (1).
-
bioRxiv - Molecular Biology 2024Quote: ... one of which expressed SpCas9 (0.5 μg of plasmid pX165 obtained from Addgene); the other plasmid (2.0 μg ...
-
bioRxiv - Molecular Biology 2024Quote: ... Guide-RNA targeting the ADPRS gene were cloned into PX459 plasmid (Addgene #62988).
-
bioRxiv - Molecular Biology 2024Quote: ... along with a pLenti6.2 expression plasmid (10 μg, Addgene #87071) carrying ARH3WT-Flag or ARH3H182RFlag using the calcium phosphate-mediated ProFection Mammalian Transfection System (Promega #E1200 ...
-
bioRxiv - Molecular Biology 2024Quote: ... were co-transfected with the packaging plasmids pCMV-dR8.2 dVPR (10 μg, Addgene #8455) and pCMV-VSV-G (10 μg ...
-
bioRxiv - Molecular Biology 2024Quote: The ARH3WT-Flag and ARH3H182R-Flag were synthesized by Gene Universal and subcloned into pDonor221 to generate pEntry plasmids prior to Gateway cloning into the appropriate pDest plasmids (pLenti6.2-DEST, Addgene #87071 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift by Titia de Lange (Addgene #18002, Addgene #18008), were used to produce lentiviral vectors in HEK 293T cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... pMDLg/pRRE and pMD2.G were procured from Addgene. For lentiviral production ...
-
bioRxiv - Neuroscience 2024Quote: ... was constructed by amplifying the promoter region of VACHT from pSPCiVACHTC (obtained from CITRES, marinebio.nbrp.jp/ciona/index.jsp) and inserting this into TRE::ChrimsonR:mCherry (obtained from Addgene, clone #99207) at the Sac1 and EcoR1 sites ...
-
bioRxiv - Neuroscience 2024Quote: ... DV - 3.8) with 200 nL AAV9.EF1a.dflox.hChR2(H134R).mCherry.WPRE.HGH (1×10^12 pp/mL, Addgene). For subjects in cohort 1 (n=2) ...
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Neuroscience 2024Quote: ... rAAV2-retro-H2B-mScarlet (Addgene#191093) and rAAV2-retro-tdTomato (Addgene #59462 ...
-
bioRxiv - Neuroscience 2024Quote: ... and rAAV2-retro-tdTomato (Addgene #59462) were produced at the University of North Carolina Viral Vector Core at 6×1012 particles/ml and 3×1012 particles/ml respectively ...
-
Direct and indirect regulation of β-glucocerebrosidase by the transcription factors USF2 and ONECUT2bioRxiv - Molecular Biology 2024Quote: ... and lentiCas9-Blast (Addgene #52962) were produced ...
-
Direct and indirect regulation of β-glucocerebrosidase by the transcription factors USF2 and ONECUT2bioRxiv - Molecular Biology 2024Quote: Lentiviruses of plasmids pXPR_120 (Addgene #96917) and lentiCas9-Blast (Addgene #52962 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.6 μg of the pMD2.g plasmid (Addgene, 12259) in Opti-MEM medium (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... the rtTA3 gene fused to the blasticidin resistant marker (BlastR) was adapted from the pLenti CMV rtTA3 Blast (w756-1) plasmid (Addgene, 26429).
-
bioRxiv - Molecular Biology 2024Quote: ... the mNeonGreen gene was obtained from the mNeonGreen-mTurquoise2 plasmid (Addgene, 98886), the rtTA3 gene fused to the blasticidin resistant marker (BlastR ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reporters were co transfected with a plasmid carrying the Cas9 gene and a guide RNA for the human AAVS1 locus (pMGS7 Addgene, #126582). Cells were cultured at low density under hygromycin selection (100 µg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 μg of the psPAX2 plasmid (Addgene plasmid no. 12260) and 0.6 μg of the pMD2.g plasmid (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... The doxycycline inducible promoter was obtained from the pCW57.1 plasmid (Addgene, 41393), the mNeonGreen gene was obtained from the mNeonGreen-mTurquoise2 plasmid (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... utilizing the plasmid pWZL hygro Flag HA TRAP220 wt (Addgene, 17433). The amplified MED1IDR sequence was inserted into the LTO-NG vector backbone using Golden Gate Assembly ...
-
bioRxiv - Molecular Biology 2024Quote: ... NORAD was overexpressed using a plasmid containing its full sequence in the pcDNA3.1 backbone (Addgene #120383, from (20)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Targeting vector was generated by replacing the OsTIR1 sequence in pMGS46 plasmid (Addgene, #126580, from (50)) with AcGFP-PRE/mPRE ...
-
bioRxiv - Molecular Biology 2024Quote: ... pMD2.G (Addgene, 12259), and pRSV-REV (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was generated from pFUGW (Addgene no. 14883) by replacing the UbC promoter-EGFP cassette with an EFS-NS-IRES-puromycin cassette ...
-
bioRxiv - Molecular Biology 2024Quote: ... or pRDA_479 (Addgene no. 179099) which expresses ABE8e (SpG ...
-
bioRxiv - Molecular Biology 2024Quote: ... pRDA_478 (Addgene no. 179096), which expresses BE3.9 (SpG) ...
-
bioRxiv - Microbiology 2024Quote: ... and SnoopCatcher22 (Addgene 72322) plasmids were purchased from Addgene and IVA was used to fuse each Catcher gene to the N-terminus of individual fluorescent proteins ...
-
bioRxiv - Microbiology 2024Quote: SpyCatcher17 (Addgene 35044), SpyCatcher00321 (Addgene 133449) ...
-
bioRxiv - Microbiology 2024Quote: ... plasmids were purchased from Addgene and IVA was used to fuse each Catcher gene to the N-terminus of individual fluorescent proteins ...
-
bioRxiv - Microbiology 2024Quote: ... SpyCatcher00321 (Addgene 133449), and SnoopCatcher22 (Addgene 72322 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The Human Ku70 gene was incorporated into the Lenti-iCas9-neo plasmid (Addgene #85400) through a two-step cloning process ...
-
bioRxiv - Microbiology 2024Quote: ... or pcDNA3-sACE2-WT(732)-IgG1 (Addgene plasmid #154104) plasmid41 was transfected into Expi293 cells using PEI at a ratio of 1:3 ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding the cytosolic domain of LjNFR5 fused to a Myc tag was cloned into plasmid pMAL-c2X (Addgene, 75286) between BamHI and HindIII and the NopM coding sequence was cloned into plasmid pACYCDuet (19 ...
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNAs were cloned into a pRDA_256 (Addgene no. 158581) vector containing SpG Cas9 NG PAM ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ebert (Addgene no. 74450). For transfection constructs ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK-293T cells were transduced with LentiCRISPR_V2 vectors (Addgene plasmid 52961; http://n2t.net/addgene:52961; RRID: Addgene_52961) encoding the indicated sgRNA sequences ...
-
bioRxiv - Molecular Biology 2024Quote: The plasmid encoding the pABE8e-protein (Addgene plasmid #161788) was used to construct the plasmid encoding the His8-SsCBE2-C2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... transfections were performed using 500 ng psPAX2 (Gag-Pol) plasmid (Addgene plasmid 12260 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The gRNAs were constructed using pRG2Z vector (Addgene #104174) and pU6-Cj-sgRNA (Addgene #89753).
-
bioRxiv - Molecular Biology 2024Quote: ... the following pair of oligomers was annealed and cloned into pUC57-sgRNA vector (Addgene plasmids #51132): 5′−TAGGACCTCAGTTC CCCTTCAAAG−3′ and 5′−AAAC CTTTGAAGGGGAACTGAGGT−3′ ...
-
bioRxiv - Molecular Biology 2024Quote: The plasmid containing pCMV-MMLVgag-3xNES-ABE8e was a gift from David Liu (Addgene plasmid #181751). Construction of the plasmid encoding pCMV-MMLVgag-3xNES-SsCBE2-C2 was accomplished through Gibson assembly ...
-
bioRxiv - Molecular Biology 2024Quote: The human codon optimized SsdAtox domain was synthetized (Integrated DNA Technologies) and cloned into either the N-terminus or C-terminus of a modified pCMV_BE4max vector (Addgene #112093) with the UGI domain deleted ...