Labshake search
Citations for Addgene :
351 - 400 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers 11 bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, # 139098). Plasmid clones were validated by Sanger sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... and pLV-tetO-Tfap2c (Addgene, #70269) were obtained from Addgene ...
-
bioRxiv - Biochemistry 2024Quote: Xenopus tropicalis TTLL10 (res. 105-570) was cloned into pCoofy28 (Addgene plasmid #44004) and bacmid was produced by transformation of DH10EMBacY (Geneva Biotech) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the sequences described above were cloned in frame with the signal peptide NLS (in plasmid pICH86988; Addgene (www.addgene.org) # 48076 ...
-
bioRxiv - Molecular Biology 2024Quote: ... # 48076) and a transit peptide (in plasmid pICH78133; Addgene # 50292) to target the biosensor to the nuclei and chloroplast stroma respectively ...
-
bioRxiv - Immunology 2024Quote: ... and packaging plasmids pCMVR8.74 (Addgene, Cambridge, MA, USA). The titers and multiplicity of infection (MOI ...
-
bioRxiv - Cell Biology 2024Quote: ... The gRNA oligos were annealed and inserted into the CasRx vector (Addgene: # 134842) linearized by BsmBI (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... and cloned using a BbsI restriction enzyme digested vector according to the method mentioned by the Feng Zhang lab at the MIT in Addgene (Addgene #62988)42 ...
-
bioRxiv - Cell Biology 2024Quote: ... Dyche Mullins at UCSF (Addgene plasmid # 58473) and MDA-MB-231 cells were a gift from Dr ...
-
bioRxiv - Molecular Biology 2024Quote: The 2C::tdTomato reporter cell line was generated by transfection of EB3 mESCs (catalog no. AES0139, RIKEN BRC Cell Bank) with a linearized 2C::tdTomato reporter plasmid (catalog no. 40281, Addgene). After 48 h ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides were purchased from Sigma-Aldrich and cloned into the pX335 vector (Addgene #42335). Respective px335-guideRNA constructs were transfected into HeLa cells on five consecutive days and separated via serial dilution to obtain monoclones ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected 24h before the imaging with Str-Ii_VSVG-SBP-EGFP (Addgene #65300). Live imaging was performed with a spinning disk microscope for 45 min and one frame was acquired every 30 sec ...
-
bioRxiv - Cell Biology 2024Quote: ... primers were purchased from Sigma-Aldrich and cloned into a gRNA Cloning Vector (gift from George Church (Addgene plasmid # 41824)) after digestion with AflII and through the Gibson assembly of the PCR product of the primer pair (guide sequence sense strand 5’-TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGCGCCATGACCCTGATTGAA G –3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were previously transduced with a Lentiviral vector expressing ACE2 using the lentiviral construct RRL.sin.cPPT.SFFV/Ace2.WPRE (MT136) kindly provided by Caroline Goujon (Addgene plasmid # 145842) (Rebendenne et al ...
-
bioRxiv - Cell Biology 2024Quote: Str-Ii_VSVG-SBP-EGFP was a gift from Franck Perez (Addgene plasmid # 65300 ...
-
bioRxiv - Cell Biology 2024Quote: ... For G3BP1 live imaging a GFP-G3BP1 fusion protein containing plasmid (pEGFP-C1-G3BP1-WT, Addgene plasmid # 135997) was transfected with Lipofectamine™ 3000 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: pBABE-puro was a gift from Hartmut Land & Jay Morgenstern & Bob Weinberg (Addgene plasmid # 1764 ...
-
bioRxiv - Cell Biology 2024Quote: Str-Ii_VSVG-SBP-EGFP was a gift from Franck Perez (Addgene plasmid # 65300; http://n2t.net/addgene:65300; RRID:Addgene_65300).
-
bioRxiv - Cell Biology 2024Quote: Codon optimized SLC25A48 was cloned from Addgene plasmid #131995 and cloned into pMSCV-blasticidin (Addgene #75085 ...
-
bioRxiv - Cell Biology 2024Quote: Codon optimized SLC25A48 was cloned from Addgene plasmid #131995 and cloned into pMSCV-blasticidin (Addgene #75085) with Flag-tag on C-terminus ...
-
bioRxiv - Neuroscience 2024Quote: ... The V5-TurboID-NES plasmid (Addgene, #107169) was transformed using a competent E ...
-
bioRxiv - Neuroscience 2024Quote: The construct utilized for a transfection control comprised of an overexpression of methionine-tRNA synthetase (MeTRS) (AddGene, pMarsL274G) were created and sequenced using protocol described above.
-
bioRxiv - Neuroscience 2024Quote: ... that was first PCR amplified using custom primers (see Table 2) from a plasmid containing lexAop2 (lexAop2-myr-4xSNAPf, RRID: Addgene 87638) and then restriction digested using HindIII and PspXI (New England BioLabs ...
-
bioRxiv - Neuroscience 2024Quote: ... and pCMVR8.74 (Addgene plasmid #22036, RRID:Addgene_22036) were gifts from Didier Trono ...
-
bioRxiv - Cell Biology 2024Quote: ... The hDLXI56i enhancer was originally obtained from CN1851-rAAV-hI56i-minBglobin-iCre-4×2C-WPRE3-BGHpA (Graybuck et al., 2021) (Addgene #164450).
-
bioRxiv - Cell Biology 2024Quote: The following plasmids from Addgene were used:
-
bioRxiv - Cell Biology 2024Quote: ... pRS416-yZ3EV-Z3pr-yEGFP (RB3579) was a gift from David Botstein (Addgene plasmid # 69100; RRID:Addgene_69100)
-
bioRxiv - Cell Biology 2024Quote: ... pRS416-yZ3EV-Z3pr-yEGFP (RB3579) was a gift from David Botstein (Addgene plasmid # 69100; RRID:Addgene_69100)
-
bioRxiv - Cell Biology 2024Quote: ... were obtained from Addgene. Primer sequences are listed in Supplementary Table 1.
-
bioRxiv - Cell Biology 2024Quote: ... pPyCAG-Pbase and pPB-CAG-rtTA-IN (Addgene, #60612) were kindly provided by M ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293 cells transfected with either cmv-gfp (control; Addgene 11153) or cmv-CAPS-FLAG were plated in a 96-well plate ...
-
bioRxiv - Cell Biology 2024Quote: ... psPAX2 (Addgene, #12260), pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... or lentiCRISPRV2-Neo (Addgene #98292 where the puromycin resistance gene was replaced with the G418 resistance gene ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pMD2.G (Addgene #12259) in a ratio of 4:3:1 ...
-
bioRxiv - Cancer Biology 2024Quote: Lentiviruses were made by Lipofectamine 2000-based co-transfection of 293FT cells with the respective lentiviral expression vectors and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the annealed oligos were ligated into LentiCRISPRV2-Puro (Addgene # 98290) or lentiCRISPRV2-Neo (Addgene #98292 where the puromycin resistance gene was replaced with the G418 resistance gene ...
-
bioRxiv - Molecular Biology 2024Quote: A CRISPR-Cas9 plasmid targeting the region adjacent to the start codon of the ATAD5 gene (CACCGGCTGTGGTACCAGGTCACG/agg) was constructed using pX330-U6-Chimeric_BB- CBh-hSpCas9 (Addgene 42230) (Ran et al ...
-
bioRxiv - Cell Biology 2024Quote: ... a PCR-amplified repair template or a synthetic oligo harboring the desired modification flaked by 50-bp homology was co-transformed alongside the bRA89 plasmid bearing Cas9 and the locus-specific 20-bp guide-RNA (from James Haber, Addgene plasmid no. 100950). Ligation of the locus-specific guide-RNA into the bRA89 plasmid was performed for each guide-RNA as previously described54 ...
-
bioRxiv - Cell Biology 2024Quote: ... Zhang’s lab [282] (for details, see plasmid reference #5296113 on Addgene website).
-
bioRxiv - Cell Biology 2024Quote: pBABE-puro was a gift from Hartmut Land & Jay Morgenstern & Bob Weinberg (Addgene plasmid # 1764; http://n2t.net/addgene:1764; RRID:Addgene_1764)
-
bioRxiv - Cell Biology 2024Quote: ... The full-length MDM2 coding sequence was isolated from Addgene plasmid #16233 (pcDNA3 FRT MDM2 ...
-
bioRxiv - Cell Biology 2024Quote: ... The mammalian expression eGFP-MDM2 overexpression plasmid was generated by subcloning the eGFP-MDM2 insert into a pMK232 vector (Addgene #72834) following NdeI (NEB #R0111S)-XhoI (NEB #R0146 ...
-
bioRxiv - Cell Biology 2024Quote: ... and psPAX2 (Addgene #12260) (gifts from Didier Trono ...
-
bioRxiv - Cell Biology 2024Quote: ... pBOB-EF1-FastFUCCI-Puro (Addgene, #86849), pMD2.G (Addgene #12259 ...
-
Autism genes converge on microtubule biology and RNA-binding proteins during excitatory neurogenesisbioRxiv - Systems Biology 2024Quote: ... Top and bottom oligos were annealed and the annealed products were inserted into a linearized lentiviral vector pMK1334 (Addgene, Cat#127965) through ligation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Kosuke Yusa from the Sanger Institute (Addgene #67978). Four days post-transduction ...
-
bioRxiv - Plant Biology 2024Quote: ... The platinum TALEN ORFs designed to recognize the target sequences were assembled by platinum gate assembly kit (Addgene) (Sakuma et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... All plasmids required for assembling the tandem expression vectors for mitoTALENs in Ti plasmids are available from Addgene (Arimura, 2021). The Ti plasmid backbone is originally from a VIB Gateway vector ...
-
bioRxiv - Cancer Biology 2024Quote: ... were co-transfected with a construct of interest and packaging plasmids Gag-Pol 8.91 (Addgene #187441) and VSV-G (Addgene #8454 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and VSV-G (Addgene #8454) using Lipofectamine 3000 (Thermo Fisher Scientific) ...