Labshake search
Citations for Addgene :
201 - 250 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... AICSDP-82:SON-mEGFP was a gift from Allen Institute for Cell Science (Addgene plasmid # 133964 ...
-
bioRxiv - Cell Biology 2024Quote: ... pECFP(C1)-NIPP1 (Addgene plasmid # 44226; http://n2t.net/addgene:44226; RRID:Addgene_44226), pEGFP(C1)-PP1alpha (Addgene plasmid # 44224 ...
-
bioRxiv - Cell Biology 2024Quote: ... APEX2-NLS was a gift from Alice Ting (Addgene plasmid # 124617 ...
-
bioRxiv - Neuroscience 2024Quote: pEGFP-Q23 and pEGFP-Q74 plasmids were a gift from David Rubinsztein (Addgene plasmid # 40261 and 40262) [44] ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligos were designed and cloned into the CRISPRi-v2 sgRNA plasmid pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene plasmid #60955) using sequences from (Horlbeck et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... in 200 uL of OptiMEM with 0.8 ug of the I-SceI expression plasmid (pCBASce, Addgene #60960). The media was replaced the next morning and the cells were trypsinized 48-hours post-transfection for analysis of GFP expression by flow cytometry (BD Biosciences).
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with lentivirus generated from the PIP-FUCCI plasmid (Addgene plasmid #138715) as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 10 sgRNAs per gene (hCRISPRi-v2; both the “top5” and “supp5” libraries from Addgene #1000000090) were prepared as described in (Palmer et al. ...
-
bioRxiv - Synthetic Biology 2024Quote: All mammalian plasmids expressing Cas9 and deadCas9-fused transcriptional activators were acquired from Addgene: dCas9-Vp64 (#47107) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The fragments were inserted into an XhoI and PsyI linearized plasmid (Addgene #112685) harboring the Cas9-T2A-eGFP expression cassette and an Opie2-DsRed marker ...
-
bioRxiv - Plant Biology 2024Quote: ... plasmids were obtained from Addgene or were kindly provided by Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... hTERT-RPE1 cells were edited to create a functionally null puromycin resistance cassette through delivery of two pX461 vectors (Addgene #48140) containing the appropriate guide RNA (gRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single clones were obtained by fluorescence-activated cell sorting and functionally tested for Cas9 activity using a lentiviral reporter pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W (Addgene #67980). PPM1D-mutant cell lines were generated using the RNP-based CRISPR/Cas9 delivery method using a single sgRNA (GCTAAAGCCCTGACTTTA) ...
-
bioRxiv - Cancer Biology 2024Quote: Gene-specific sgRNAs were cloned into the pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP (Addgene #67974) lentiviral backbone ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 7.5 ug of the Human Improved Whole-Genome Knockout CRISPR library V1 (by Kosuke Yuya, Addgene #67989), 18.5 ug of psPax2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the plasmid pHR-UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB (Addgene plasmid #154473) was transduced into cells as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 (Addgene) and pMD2.G (Addgene) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pMD2.G (Addgene), and polyethylenimine (1 μg/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... The lentiviral E-cadherin-EGFP were generated from pCS-CG (Addgene) for E-cadherin knock-in of MDA-MB-231 as previously described [58] ...
-
bioRxiv - Cancer Biology 2024Quote: The full-length human HK2 open reading frame (ORF) flanked by the linkers was amplified by PCR using plasmid FLHKII-pGFPN3 (RRID:Addgene_21920) as a template with primers (GGGTCCTGGTTCGATGATTGCCTCGCATCTGCTTGCCTACTTC and CTTGTTCGTGCTGTTTACTATCGCTGTCCAGCCTCACGGATGCGGC ...
-
bioRxiv - Cancer Biology 2024Quote: ... was a gift from Kosuke Yusa (Addgene #50947) (11) ...
-
bioRxiv - Cancer Biology 2024Quote: ... libraries with 5 sgRNAs per gene (mCRISPRi-v2; the “top5” library from Addgene #1000000092) or 10 sgRNAs per gene (hCRISPRi-v2 ...
-
bioRxiv - Cancer Biology 2024Quote: To generate ER-Hoxa9 mCherry-Geminin cells, the mCherry-Geminin fusion gene (Sakaue-Sawano et al., 2008) was cloned into the pLV-Hygro vector (Addgene plasmid #85134), using Gibson cloning ...
-
bioRxiv - Biochemistry 2024Quote: ... or 74 CAG repeats (GFP-Q74: mutant HTT. Addgene, #40262). Vectors to alpha synuclein were a gift from our collaborator Dr ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Cell Biology 2024Quote: ... tropicalis proteins were cloned into the pHAT2 vector (Addgene #112583) using NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621) ...
-
bioRxiv - Cell Biology 2024Quote: ... control or mir-218-1-overexpressing HTR8 cells were seeded into 12-well plates and were co-transfected with 1 µg/mL of 5X NFκB luciferase reporter (64) (Addgene plasmid #12453) construct and 20 ng/mL of Renilla luciferase vector (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... 13 µg pCMVR8.74 (gift from Didier Trono, Addgene plasmid #22036; http://n2t.net/addgene:22036; RRID:Addgene_22036) and 7 µg pMD2.G (gift from Didier Trono ...
-
bioRxiv - Cell Biology 2024Quote: ... 13 µg pCMVR8.74 (gift from Didier Trono, Addgene plasmid #22036 ...
-
bioRxiv - Cell Biology 2024Quote: ... berghei Nup138 the smHA coding sequence was amplified from plasmid pCAG_smFP_HA(Addgene #59759) using primers P4121/4122 and inserted between BamHI/BsiWI immediately downstream of the Pbnup138 homology region in the plasmid pLIS0654 (Ambekar Sushma ...
-
bioRxiv - Bioengineering 2024Quote: ... The full-length SpRY CBE4max construct was purchased from Addgene (Plasmid #139999). The full-length SpRY ABE8e plasmid was generated through Gibson Assembly of gBlock Gene Fragments (Integrated DNA Technologies ...
-
bioRxiv - Bioengineering 2024Quote: The plasmid encoding the U6-sgRNA expression cassette was obtained from Addgene (#47108). The full-length SpRY CBE4max construct was purchased from Addgene (Plasmid #139999) ...
-
bioRxiv - Biochemistry 2024Quote: ... and packaging plasmids (psPAX2, Addgene #12260; pMD2.G, Addgene #12259) was prepared in serum-free media (Opti-MEM™ ...
-
bioRxiv - Biochemistry 2024Quote: ... and packaging plasmids (psPAX2, Addgene #12260; pMD2.G, Addgene #12259) was prepared in serum-free media (Opti-MEM™ ...
-
bioRxiv - Biochemistry 2024Quote: ... a ∼1:1:1 molar ratio mixture of library transfer (lentiCRISPRv2; Addgene plasmid #52961) and packaging plasmids (psPAX2 ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: RNH1-KO K562 cells were infected with lentiviruses expressing ANG (pLenti CMV Blast GFP-ANG) or the empty vector pLenti CMV Blast DEST (706-1, Addgene) as previously described 52 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1.7 μg psPAX2 (Addgene #12260), 48.8 μg PEI (1 μg/μL ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.85 μg pMD2.G (Addgene #12259), 1.7 μg psPAX2 (Addgene #12260) ...
-
bioRxiv - Biochemistry 2024Quote: ... 2xStrep-Flag-FOXA1-HA was introduced to pINDUCER21 (Addgene #46948) to generate pINDUCER21_FOXA1 by Gateway cloning protocol (Thermo).
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... The pET28a-TRBP was purchased from Addgene (Addgene plasmid # 50351). The pET28a-TRBP plasmid was transformed into E ...
-
bioRxiv - Biochemistry 2024Quote: ... The pET28a-TRBP was purchased from Addgene (Addgene plasmid # 50351). The pET28a-TRBP plasmid was transformed into E ...
-
bioRxiv - Biochemistry 2024Quote: ... packaging plasmid - pCMV-dR8.2 dvpr (Addgene #8455) in a 6:4:1 ratio using PEI-max (Polysciences #24765-100) ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... the human Angiogenin (ANG) full coding sequence (ORIGEN RC 208874) was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... and then recombined into the destination vector pLenti CMV Blast DEST (706-1, Addgene) plasmid using the Gateway cloning method.
-
bioRxiv - Bioengineering 2024Quote: YAP/TAZ-TRE-mStrawberry reporter was a gift from Ravid Straussman (Addgene plasmid # 158682). From this plasmid ...
-
bioRxiv - Bioengineering 2024Quote: ... David Liu at Harvard University (Addgene plasmids #75145 and #75146). Sortase enzymes were expressed and purified as previously described (Supplementary Method S3 ...
-
bioRxiv - Bioengineering 2024Quote: ... and pRSV-REV (Addgene #12253), and the YAP/TAZ-TRE-tdTomato plasmid using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Bioengineering 2024Quote: ... packaging plasmids pMDLG/pRRE (Addgene #12251) and pRSV-REV (Addgene #12253) ...