Labshake search
Citations for Addgene :
201 - 250 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... pDEST-566 was a gift from Dominic Esposito (Addgene plasmid #11517 ...
-
bioRxiv - Cell Biology 2024Quote: ... expressing a gRNA targeted against hTUBA1B (gGATGCACTCACGCTGCGGGA) and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles were produced in HEK293 cells after transient transfection of the packaging vectors psPAX.2 and pMD.G2 (Addgene #12260 and #12259). After viral transduction ...
-
bioRxiv - Cell Biology 2024Quote: ... and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Cell Biology 2024Quote: ... U2OS cells were co-transfected with pLentiCRISPRv266 (Addgene plasmid # 52961 ; RRID:Addgene_52961) expressing a gRNA targeted against hTUBA1B (gGATGCACTCACGCTGCGGGA ...
-
bioRxiv - Developmental Biology 2024Quote: ... was PCR amplified from pJW2171 (Addgene plasmid #163095) and concentrated using a PCR purification kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2024Quote: Both pWZ186 (Addgene plasmid #163641) and a plasmid containing 2xmTurquoise2 were double digested with Bsu36I and NgoMIV to excise 2xmKate2 and 2xmTurquoise2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA fragments for the open reading frame of the mCherry protein and the backbone plasmid were amplified using the pENTR R4-mCherry-R3 plasmid (Addgene #32311) as a template ...
-
bioRxiv - Developmental Biology 2024Quote: ... into the T444T vector (Addgene plasmid #113081) using the BglII and XhoI restriction sites (Sturm et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... pH2B-mNG211 (Addgene #206043) was generated by amplifying the H2B gene from an H2B-mRuby plasmid (Beaudet et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... and ligated into the pre-digested promoter-less plasmid to generate the pAAVS1-P-CAG-mNG21-10 repair template (Addgene #206042). For BclI digestion ...
-
bioRxiv - Cell Biology 2024Quote: ... The left and right homology arms for the AAVS1 locus and the puromycin gene were amplified individually from the pAAVS1-P-CAG-GFP plasmid (Addgene #80491; Oceguera-Yanez et al., 2016). These fragments were cloned into the pYTK089 backbone by Golden Gate using a standard protocol (Lee et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Kdm3a microhomology arms were added to the pCRIS-PITChv2-Puro-dTAG (Addgene #91793) donor vector and Kdm3b microhomology arms were cloned into the pCRIS-PITChv2-BSD-dTAG (Addgene #91792 ...
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs targeting luciferase or mouse Nr1h3 and Rara were cloned into the pLKO.1 vector (Addgene, MA, USA, #8453). The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 (Addgene, MA, USA, #12263) and pCMV-VsVg (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... eGFP-BICD1 (Addgene #49487 ...
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... AICSDP-82:SON-mEGFP was a gift from Allen Institute for Cell Science (Addgene plasmid # 133964 ...
-
bioRxiv - Cell Biology 2024Quote: ... pECFP(C1)-NIPP1 (Addgene plasmid # 44226; http://n2t.net/addgene:44226; RRID:Addgene_44226), pEGFP(C1)-PP1alpha (Addgene plasmid # 44224 ...
-
bioRxiv - Cell Biology 2024Quote: ... APEX2-NLS was a gift from Alice Ting (Addgene plasmid # 124617 ...
-
bioRxiv - Neuroscience 2024Quote: pEGFP-Q23 and pEGFP-Q74 plasmids were a gift from David Rubinsztein (Addgene plasmid # 40261 and 40262) [44] ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligos were designed and cloned into the CRISPRi-v2 sgRNA plasmid pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene plasmid #60955) using sequences from (Horlbeck et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... in 200 uL of OptiMEM with 0.8 ug of the I-SceI expression plasmid (pCBASce, Addgene #60960). The media was replaced the next morning and the cells were trypsinized 48-hours post-transfection for analysis of GFP expression by flow cytometry (BD Biosciences).
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with lentivirus generated from the PIP-FUCCI plasmid (Addgene plasmid #138715) as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 10 sgRNAs per gene (hCRISPRi-v2; both the “top5” and “supp5” libraries from Addgene #1000000090) were prepared as described in (Palmer et al. ...
-
bioRxiv - Synthetic Biology 2024Quote: All mammalian plasmids expressing Cas9 and deadCas9-fused transcriptional activators were acquired from Addgene: dCas9-Vp64 (#47107) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The fragments were inserted into an XhoI and PsyI linearized plasmid (Addgene #112685) harboring the Cas9-T2A-eGFP expression cassette and an Opie2-DsRed marker ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The plasmid backbone (pU6-pegRNA-GG-acceptor, Addgene #132777) was digested using BsaI-HFv2 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 375 ng of PE4max enzyme plasmid (Addgene #174828), 62.5 ng of crRNA plasmid ...
-
bioRxiv - Plant Biology 2024Quote: ... plasmids were obtained from Addgene or were kindly provided by Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... hTERT-RPE1 cells were edited to create a functionally null puromycin resistance cassette through delivery of two pX461 vectors (Addgene #48140) containing the appropriate guide RNA (gRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single clones were obtained by fluorescence-activated cell sorting and functionally tested for Cas9 activity using a lentiviral reporter pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W (Addgene #67980). PPM1D-mutant cell lines were generated using the RNP-based CRISPR/Cas9 delivery method using a single sgRNA (GCTAAAGCCCTGACTTTA) ...
-
bioRxiv - Cancer Biology 2024Quote: Gene-specific sgRNAs were cloned into the pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP (Addgene #67974) lentiviral backbone ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 7.5 ug of the Human Improved Whole-Genome Knockout CRISPR library V1 (by Kosuke Yuya, Addgene #67989), 18.5 ug of psPax2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the plasmid pHR-UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB (Addgene plasmid #154473) was transduced into cells as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 (Addgene) and pMD2.G (Addgene) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pMD2.G (Addgene), and polyethylenimine (1 μg/mL ...
-
bioRxiv - Cancer Biology 2024Quote: The GeCKO CRISPR library was purchased from Addgene (#1000000048), amplified ...
-
bioRxiv - Cancer Biology 2024Quote: ... The lentiviral E-cadherin-EGFP were generated from pCS-CG (Addgene) for E-cadherin knock-in of MDA-MB-231 as previously described [58] ...
-
bioRxiv - Cancer Biology 2024Quote: The full-length human HK2 open reading frame (ORF) flanked by the linkers was amplified by PCR using plasmid FLHKII-pGFPN3 (RRID:Addgene_21920) as a template with primers (GGGTCCTGGTTCGATGATTGCCTCGCATCTGCTTGCCTACTTC and CTTGTTCGTGCTGTTTACTATCGCTGTCCAGCCTCACGGATGCGGC ...
-
bioRxiv - Cancer Biology 2024Quote: ... was a gift from Kosuke Yusa (Addgene #50947) (11) ...
-
bioRxiv - Cancer Biology 2024Quote: ... libraries with 5 sgRNAs per gene (mCRISPRi-v2; the “top5” library from Addgene #1000000092) or 10 sgRNAs per gene (hCRISPRi-v2 ...
-
bioRxiv - Cancer Biology 2024Quote: To generate ER-Hoxa9 mCherry-Geminin cells, the mCherry-Geminin fusion gene (Sakaue-Sawano et al., 2008) was cloned into the pLV-Hygro vector (Addgene plasmid #85134), using Gibson cloning ...
-
bioRxiv - Biochemistry 2024Quote: ... or 74 CAG repeats (GFP-Q74: mutant HTT. Addgene, #40262). Vectors to alpha synuclein were a gift from our collaborator Dr ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding amino acids 1-393 of the p53 protein with a FLAG tag at the C-terminus (Addgene plasmid #10838) was used as a template for site-directed mutagenesis to delete the N-terminal regions spanning amino acids 1-31 ...
-
bioRxiv - Biochemistry 2024Quote: ... The SV40 Large T antigen and HA-TRIM71 were purchased from Addgene (plasmid # 136616 and #52717 ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: Single guide RNA oligonucleotides were cloned into the pSpCas9-2A-GFP vector (Addgene #48138). The guide sequences were as follows ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for eGFP-tagged SpvB(Salmonella SpvB 375-591) sequence were obtained from Addgene (#89446) and cloned into the pMSCV-puro vector.