Labshake search
Citations for Addgene :
601 - 650 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Bilateral regulation of EGFR activity and local PI dynamics observed with superresolution microscopybioRxiv - Cell Biology 2024Quote: ... and cloned into the PX459 vector (#48139, Addgene) at the BbsI site ...
-
bioRxiv - Molecular Biology 2024Quote: ... the HEK293T cells were transfected with the respective constructs along with envelope plasmid (pMD2.G) (Addgene, Cat# 12259), and packaging plasmid (psPAX2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... C-terminally FLAG-tagged ASXL1 p.G646Wfs*12 and p.Y591X were obtained from Addgene. The MSCV-T2A-Puromycin vectors encoding 3xFLAG-tagged full-length ASXL1 and truncated ASXL1 were generated by PCR amplification followed by sub-cloning using Gibson assembly.
-
bioRxiv - Molecular Biology 2024Quote: ... and packaging plasmid (psPAX2) (Addgene, 12260) using Lipofectamine 3000 according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a non-targeting control (F: GCACTACCAGAGCTAACTCAGATAGTACT) were designed using the BROAD Institute design tool and cloned into pLKO.1 vector (Addgene, Cat# 8453), followed by validating the successful insertions using Colony-PCR and Sanger sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... They were cloned into lentiCRISPR-v2 (Addgene, Cat# 52961) following the GeCKO protocol with slight modifications64 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCBASceI plasmid (1.5 µg) (Addgene, 26477)(55) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then cloned into pWPXL vector (Addgene #12257) generating pwpxl-tsTE1 plasmid for overexpression assay in vitro.
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene: 52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... TCOF1-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid # 129716) using In-Fusion cloning ...
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Cell Biology 2024Quote: ... and pmGFP-P2A-K20-P2A-RFP (Addgene #105688) have been described previously 36.
-
bioRxiv - Molecular Biology 2024Quote: ... BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Molecular Biology 2024Quote: ... BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Cell Biology 2024Quote: ... These two plasmids were co-electroporated with a plasmid encoding the sgRNA for the gene locus (Supplementary Table 2, Addgene #47108 ...
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders ...
-
bioRxiv - Molecular Biology 2024Quote: ... To generate Ogt iKO mESC carrying the 2C-reporter we used the MERVL::tdTomato reporter [51] that was kindly shared from Samuel Pfaff (Addgene #40281). Reporter stable cell line was generated by transfection (Lipofectamine™ 2000 ...
-
bioRxiv - Cell Biology 2024Quote: ... pMDL (Addgene, #12251), and either the tetracycline transactivator (TTA ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293T cells were transfected with the DNA of lentiviral packaging plasmids vSVG (Addgene, USA, #8454), RSV (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... These plasmids and their sequence information are available from Addgene. Cell lines
-
bioRxiv - Cell Biology 2024Quote: ... GFP-OMP25 was a gift of Gia Voeltz (Addgene 141150). BFP-OMP25 and mCherry- OMP25 were generated by cloning the OMP25 cassette from GFP-OMP25 into the XhoI/BamHI sites of pTagBFP-C and pmCherry-C1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Halo-MTS (referred to as mito-HaloTag; a gift of Jin Wang; Addgene 124315) and mito-mCherry (Kumar et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from Alice Ting (Addgene plasmid #107172 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from Alice Ting (Addgene plasmid #107172; http://n2t.net/addgene:107172; RRID:Addgene_107172). For the GFP–TAF1 construct ...
-
bioRxiv - Developmental Biology 2024Quote: ... and pMD2.G (Addgene; 12259) were used for lentivirus packaging ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLX209-neo-WRN K577M were a gift from Francisca Vazquez (respectively, Addgene plasmids # 125788, http://n2t.net/addgene:125788; RRID:Addgene_125788; #125789, http://n2t.net/addgene:125789; RRID:Addgene_125789 and # 125790 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the Cas9 plasmid PX458 (Addgene, #48138). Clonal colonies were initially screened by PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then transfected with 0.5 to 1 μg pCDNA3-HA-hMYCN (Addgene #74163) using JetPrime® (Polyplus Transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from Masato Kanemaki (Addgene plasmid # 72833; http://n2t.net/addgene:72833; RRID:Addgene_72833)65 and the pSH-EFIRES-P-AtAFB2-mCherry-weak NLS vector as a donor ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from Elina Ikonen (Addgene plasmid # 129717 ...
-
bioRxiv - Cancer Biology 2024Quote: HEK293 cells were cultured in 6-well plates and then transfected with 4 μg of previously described plasmid vectors encoding ER stress reporter genes ATF4-mS (#115970, Addgene, Cambridge, MA, USA), XBP1-mN (#115971) ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pMD2.G (Addgene) plasmids ...
-
bioRxiv - Cancer Biology 2024Quote: ... plentiCRISPR v2 (Addgene) using Blunt/TA Ligase (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from Bob Weinberg (Addgene plasmid # 24150; http://n2t.net/addgene:24150; RRID:Addgene_24150). The shRNA was co-transfected into HEK-293FT cells with 4 μg psPAX2 and 4 μg VSV-G plasmids using Lipofectamine 3000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from David Sabatini (Addgene plasmid # 1864 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from Feng Zhang (Addgene plasmid # 42230; http://n2t.net/addgene:42230; RRID:Addgene_42230).144 For the MYC-AID lines ...
-
bioRxiv - Cancer Biology 2024Quote: ... They were cloned separately into lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from Elina Ikonen (Addgene plasmid # 129717; http://n2t.net/addgene:129717; RRID:Addgene_129717).64
-
bioRxiv - Cancer Biology 2024Quote: All-in-One-GFP and All-in-One-mCherry plasmids were purchased from Addgene (AIO-GFP #74119 and AIO-mCherry #74120). Their constructions have been described in (22).
-
bioRxiv - Molecular Biology 2024Quote: The ORF of INTS6 was cloned into plasmid 438C (pFastBac His6 MBP Asn10 TEV cloning vector with BioBrick Polypromoter LIC subcloning, Addgene plasmid #55220). Constructs 438B-INTS3 ...
-
bioRxiv - Neuroscience 2024Quote: ... pLV-dCas9-p300-P2A-PuroR was a gift from Charles Gersbach (Addgene plasmid # 83889 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 400nl of AAV8-Ef1a-Con/Foff 2.0-BFP (Addgene viral prep # 137130-AAV8) was injected into M1 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-DJ-hSYN1::mTurquoise2 (Produced by Stanford University Neuroscience Gene Vector and Virus Core using Addgene, plasmid #99125), AAV-DJ-hSYN1::mCherry (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-DJ-EF1α::CVS-G (Produced by Stanford University Neuroscience Gene Vector and Virus Core using Addgene, plasmid #67528), AAV-DJ-EF1-DIO-tdTomato (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Neuroscience 2024Quote: ... 1.03 × 1013 vg/mL), and AAV-mCherry (pAAV9-hSyn-mCherry; 114472-AAV9, 9.0 × 1012 vg/mL) viruses were purchased from Addgene. AAV-Rem2-wt (AAV9-hSyn1-Myc-Rem2-WPRE ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-hSYN1::Cre (Addgene, #105553), AAV-DJ-EF1α::DIO-GCaMP6s (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Neuroscience 2024Quote: ... The viral vectors containing the Cre-dependent plasmid pAAV-hSyn-DIO-hM4D(Gi)-mCherry (AddGene #44362-AAV8; titer of 2.1×1013 GC/mL), Cre-dependent control plasmid pAAV-hSyn-DIO-mCherry (AddGene #50459-AAV8 ...