Labshake search
Citations for Addgene :
601 - 650 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Jeffrey Rosen (Addgene plasmid #81018 ...
-
bioRxiv - Cancer Biology 2024Quote: ... BG4 (0.5 µg, expressed from the pSANG10-3F-BG4 plasmid (Addgene 55756), kindly provided by S ...
-
bioRxiv - Cancer Biology 2024Quote: ... or a control plasmid pBABE-puro (Gift from Hartmut Land, Jay Morgenstern and Bob Weinberg (RRID:Addgene_1764)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pMD2.G (RRID:Addgene_12259) gifts of Didier Trono (63) ...
-
bioRxiv - Cancer Biology 2024Quote: ... L363 and KMS12 cells were transduced with the lentiviral vector pInducer20 (RRID:Addgene 44012, Gift of Stephen Elledge) harboring a Tet operator-controlled KDM6A cDNA (pKDM6A ...
-
bioRxiv - Cancer Biology 2024Quote: ... MEF cells were transduced with the retroviral vector pBABE-puro-KRASG12V (Gift from Christopher Counter (RRID:Addgene 46746) or a control plasmid pBABE-puro (Gift from Hartmut Land ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing a C-terminus EGFP-tagged sequence of the full-length M237I p53 protein (Addgene, #11770), and 4 µL of Lipofectamine 2000 reagent ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pNIC-CTHF vectors (Addgene, #39077), respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... The lentiviral vector pLX311-luciferase was a gift from William Hahn (Addgene plasmid #117735). Parental cells were transduced with pCDH-GFP-luc or pLX311-luc ...
-
bioRxiv - Cell Biology 2024Quote: ... pBOB-EF1-FastFUCCI-Puro was a gift from Kevin Brindle & Duncan Jodrell (Addgene plasmid # 86849 ...
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were purchased from Addgene (Addgene#1817 ...
-
bioRxiv - Cancer Biology 2024Quote: ... envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455) packaging plasmid using polyethylenimine (Polysciences) ...
-
bioRxiv - Cancer Biology 2024Quote: ... DHB-mVenus (CDK2 activity reporter) was a gift from Tobias Meyer & Sabrina Spencer (Addgene plasmid # 136461; http://n2t.net/addgene:136461; RRID:Addgene_136461) (27).
-
bioRxiv - Cancer Biology 2024Quote: ... Feng Zhang’s lab (Addgene plasmid # 52961).
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were purchased from Addgene (Addgene#1817, Addgene#98882 ...
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were purchased from Addgene (Addgene#1817, Addgene#98882, Addgene#102930, Addgene#98877 ...
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were purchased from Addgene (Addgene#1817, Addgene#98882, Addgene#102930, Addgene#98877, Addgene#158754, Addgene#46942, Addgene#6469, Addgene#137802) (Sherer et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were purchased from Addgene (Addgene#1817, Addgene#98882, Addgene#102930, Addgene#98877, Addgene#158754, Addgene#46942, Addgene#6469, Addgene#137802) (Sherer et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were purchased from Addgene (Addgene#1817, Addgene#98882, Addgene#102930, Addgene#98877, Addgene#158754 ...
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were purchased from Addgene (Addgene#1817, Addgene#98882, Addgene#102930, Addgene#98877, Addgene#158754, Addgene#46942, Addgene#6469, Addgene#137802) (Sherer et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... mNeonGreen coding sequence was synthesized and cloned into pCRISPaint-TagRFP (Addgene plasmid # 67167)128 between BamHI/NotI sites to replace the TagRFP cassette ...
-
bioRxiv - Cancer Biology 2024Quote: ... An EP organoid line with a stable transduction of lentiCas9-blast (Addgene plasmid #52962)130 was used as the starting material ...
-
bioRxiv - Cancer Biology 2024Quote: ... a targeting vector pCRISPaint-TagRFP (Addgene plasmid # 67167) was electroporated into the organoids together with CRIPSR-RNPs directed to the targeting vector (sgFrame ...
-
bioRxiv - Cancer Biology 2024Quote: ... and p73C proteins were subcloned into pET15-b (Addgene, #24866), pET28-a ...
-
bioRxiv - Cancer Biology 2024Quote: ... The construction of the two shRNA lentivirus vectors targeting the human β-catenin was performed following the Tet-pLKO Manual given by Addgene (plasmid#21915). The shRNA sequences used were the same as previously described (16) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subcloned into the lentiviral vector pLKO.1-puro (Addgene, USA). All plasmids used in this study were verified by DNA sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 0.4μg of CRE-expressing plasmid (Addgene #172433) on a 4D-Nucleofector (Lonza ...
-
bioRxiv - Cancer Biology 2024Quote: ... A549 cells were transfected with px459-Cas9 plasmid (Addgene), carrying sgRNA for YTHDC1 “ATTCTTATAAGGTTCTCTGG” ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral plasmids containing the relevant guides were co-transfected with helper plasmids psPAX2 (Addgene Ref. 12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... and its blasticidin or hygromycin derivatives (a gift from Dr. Brett Stringer, Addgene, Refs. 98293 and 98291, respectively). Guides for human and/or mouse PHB1 ...
-
bioRxiv - Cell Biology 2024Quote: ... and pAW90.dCas9-YY1 (Addgene, 104373) plasmids were purchased from Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were purchased from Addgene. Five sgRNAs were designed by CRISPOR(56 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each plasmid was co-transfected into HEK293T cells with psPAX2 (Addgene, 12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... This fragment was subcloned by restriction (BamHI and XhoI) and ligation into the lenti-vector expression backbone plasmid pLenti-CMV-Blast-empty-(w263-1) (Addgene). Sequence integrity was validated with Sanger sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... The lentiviral packing vector psPAX2 (Addgene plasmid # 12260) and envelope vector pMD2.G (Addgene plasmid # 12259 ...
-
bioRxiv - Cancer Biology 2024Quote: ... with psPAX2 and pMD2.G (Addgene) as enzyme and packaging carriers ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLKO.1 shGFP control was obtained from Addgene (cat#30323). Wildtype IDH1 with overexpression plasmid 3X HA tag was generated by Twist Bioscience (pTwist Lenti SFFV Puro) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and cloned by GoldenGate assembly into pCFD5w (Addgene 112645; APC1 and Rab35) or pCFD6 (APC1/2 and Blackbelt) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplicons containing spacer sequences for two sgRNAs were generated from plasmid pCFD6 (Addgene 73915) using primers sgRNAampfwd ...
-
bioRxiv - Cancer Biology 2024Quote: HT29 cells previously infected with pLenti-U6-tdTomatato-P2A-BlasR (LRT2B) virus (Addgene, 1108545) that enables dual production of firefly luciferase and TdTomato were used ...
-
bioRxiv - Cell Biology 2024Quote: ... The T-REx293 cell line was transiently transfected with LentiCRISPRv2 (Addgene, #52961). The sgRNA sequences used for cloning LentiCRISPRv2-DHHC5 were ...
-
bioRxiv - Cell Biology 2024Quote: ... the full-length coding sequence (CDS) of CREB was amplified and inserted into the pcDNA3.1 plasmid (Addgene, USA). HEK293T cells were seeded in a 24-well plate and incubated for 24 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... along with 3.75 μg of psPAX2 (courtesy of Didier Trono: Addgene, #12260) and 1.25 μg of pMD2.G (courtesy of Didier Trono ...
-
bioRxiv - Cell Biology 2024Quote: ... The sequence was synthesized as oligos with BbsI overhangs and was cloned into the BbsI sites of pX459V2.0-HypaCas953 (Addgene 108294). The homology repair template to make endogenous APMAP-mNeonGreen was made from two synthesized 800-bp homology regions gene fragments (Twist Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral vectors were packaged using packaging plasmid (pCMV delta R8.2 dvpr, Addgene #8455) and the envelope plasmid (pCMV-VSV-G ...
-
bioRxiv - Cell Biology 2024Quote: ... and the envelope plasmid (pCMV-VSV-G, Addgene #8454). After 72 hours of transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... or pLKO.1-Neo-CMV-tGFP-Scramble shRNA plasmid (Addgene#136035 as scramble control). Lentiviral vectors were packaged using packaging plasmid (pCMV delta R8.2 dvpr ...
-
bioRxiv - Cell Biology 2024Quote: ... hCRISPRi-v2 library was a gift from Jonathan Weissman (Addgene ID #83969). Cells were then selected with 1.5 μg/mL puromycin (A1113803 ...
-
bioRxiv - Cell Biology 2024Quote: ... FopFLASH (Addgene#12457), Renilla (Addgene#27163) ...