Labshake search
Citations for Addgene :
451 - 500 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Lenti-Cas9 encoding Cas9 was produced from Addgene plasmid #87904 ...
-
bioRxiv - Neuroscience 2024Quote: ... GABAergic interneuron targeting was achieved with 0.45 µl of AAV1-1/2mDlx-HBB-hChR2-mcherry (Addgene 83898) (viral titer 7×1012 vg per ml ...
-
bioRxiv - Neuroscience 2024Quote: ... and Cre dependent eYFP plasmid (pSin wPGK-Cre; Addgene plasmid # 101242 and pFUdioeYFPW; Addgene plasmid # 73858, respectively) has been previously described(Chen et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... The dLight virus (700 nL of AAV5-hSyn-dLight 1.2; Addgene, Watertown, MA; Catalog No.111068-AAV5) was injected unilaterally into the NAc core (in mm ...
-
bioRxiv - Neuroscience 2024Quote: ... pSPAX2 and pMD2.G (Addgene plasmids 12260 and 12259, respectively) were transfected using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Pathology 2024Quote: ... (WT and variants) with a mTurquoise (mTq2) tag on the C-terminus were cloned into a pSBtet-pur vector (Addgene) using SfiI sites ...
-
bioRxiv - Neuroscience 2024Quote: ... and Rab10T23N were purchased from Addgene (ER-GCaMP6-150 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a hNav1.5 plasmid (Addgene plasmid #145374 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The CLYBL-targeting pC13N-iCAG.copGFP vector (Addgene #66578) [66] was used as a backbone to generate three constructs encoding different N-terminal-HiBiT-GBA1 variants (WT ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... along with left and right TALENs (pZT-C13-L1: Addgene #62196; pZT-C13-R1: Addgene #62197; 375 ng/well each) targeting the human Citrate Lyase Beta-Like (CLYBL ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... along with left and right TALENs (pZT-C13-L1: Addgene #62196 ...
-
bioRxiv - Neuroscience 2024Quote: ... or a Cre-dependent GtACR2 (pAAV1-hSyn1-SIO-stGtACR2-FusionRed, Addgene #105677) into each burr hole approximately 0.5 mm below the pial surface with an injection rate of 10-20 nl/min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Mutations were introduced using the same primers on BcLOV4-ITSN1 (Provided by Brian Chow) (Addgene #174509) to generate meltITSN1-37 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Melt mutations were introduced to WT BcLOV4 (Provided by Brian Chow) (Addgene Plasmid #114595) via whole backbone PCR using primers containing the target mutation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and pJWV102-PL-dCas9 (Addgene plasmid # 85588) donated by Jan-Willem Veening (40).
-
bioRxiv - Synthetic Biology 2024Quote: ... pMSP3535 donated by Gary Dunny (Addgene plasmid # 46886) (38) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pBS3Clux was a gift from Thorsten Mascher (Addgene plasmid # 55172). Next ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pBAV1K-T5-gfp was a gift from Ichiro Matsumura (Addgene plasmid # 26702).
-
bioRxiv - Synthetic Biology 2024Quote: ... pPEPY-PF6-lacI (Addgene plasmid # 85589) and pJWV102-PL-dCas9 (Addgene plasmid # 85588 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... a gift from Thomas Proft (Addgene plasmid # 88900) (22) ...
-
bioRxiv - Neuroscience 2024Quote: ... and Cre dependent eYFP plasmid (pSin wPGK-Cre; Addgene plasmid # 101242 and pFUdioeYFPW ...
-
bioRxiv - Synthetic Biology 2024Quote: Genes encoding each ligand were sourced from: VEGFA165 (pVax1-hVEGF165, which was a gift from Loree Heller, Addgene plasmid #74466)28 ...
-
bioRxiv - Neuroscience 2024Quote: ... 250 nl of AAVrg-hsyn-DIO-EGFP (Addgene # 50457; MA, USA) was infused into the DRN (ML = ±0.0 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and PH(Akt)-Venus (a gift from Narasimhan Gautam, Addgene plasmid #85223; http://n2t.net/addgene:85223; RRID:Addgene_85223) (O’Neill and Gautam ...
-
bioRxiv - Molecular Biology 2024Quote: ... along with envelope plasmid (pMD2.G) (Addgene, Cat# 12259), and packaging plasmid (psPAX2 ...
-
bioRxiv - Neuroscience 2024Quote: ... cultures in both chambers were infected with the genetically encoded calcium indicator (GECI) (AAV9.Syn.GCaMP6s.WPRE.SV40, Addgene) after 4 DIV ...
-
bioRxiv - Cell Biology 2024Quote: ... FLAG-SENP1 (Addgene plasmid # 17357) 35 and Ubc9 (Addgene plasmid # 20082 ...
-
bioRxiv - Cell Biology 2024Quote: ... Robert Oshima (Addgene plasmid # 45346). We also generated HA-tagged (MYPYDVPDYA ...
-
bioRxiv - Plant Biology 2024Quote: ... cleaned and combined into the PEE083 plasmid (Addgene #149279) using the Golden Gate assembly system (Engler et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Broad Institute, Boston, USA) (Addgene plasmid # 62988 ...
-
bioRxiv - Neuroscience 2024Quote: ... or the control vector (pAAV-CaMKIIa-mCherry; Addgene #114469) were bilaterally infused using a Hamilton micro-syringe (Stoelting ...
-
bioRxiv - Neuroscience 2024Quote: ... the fragments were cloned into an pJFRC7-20XUAS-IVS-mCD8::GFP vector (Addgene plasmid # 26220), replacing the mCD8::GFP insert via restriction enzyme digest (XhoI ...
-
bioRxiv - Neuroscience 2024Quote: ... commenced with stereotaxic surgery to infuse a pAAV1 CD68-hM4D(Gi)-mCherry virus (Addgene viral prep #75033-AAV1 from Bryan Roth ...
-
bioRxiv - Neuroscience 2024Quote: ... A total of 1µL of the pAAV-CaMKIIa-hM4D(Gi)-mCherry viral vector (Addgene #50477) or the control vector (pAAV-CaMKIIa-mCherry ...
-
bioRxiv - Neuroscience 2024Quote: ... pTALdNC-AAVS1_T1 (Addgene # 80495), and pUCM-AAVS1-TO-hNGN2 (Addgene #105840 ...
-
bioRxiv - Neuroscience 2024Quote: ... and pUCM-AAVS1-TO-hNGN2 (Addgene #105840) in Lipofectamine stem transfection reagent (Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-TRE-fDIO-GFP-IRES-tTA (Addgene #118026) and either cytoplasmic.turboID ...
-
bioRxiv - Neuroscience 2024Quote: Adult mice were injected in the barrel cortex with 200nl of AAV mix consisting of pAAV-TRE-DIO-FLPo (Addgene #118027), pAAV-TRE-fDIO-GFP-IRES-tTA (Addgene #118026 ...
-
bioRxiv - Neuroscience 2024Quote: Adeno-associated virus (AAV) type 2 carrying cre-dependent ChR2-eYFP (Addgene plasmid 20298 ...
-
bioRxiv - Neuroscience 2024Quote: The following commercial viruses were produced by AddGene: rAAVretro-EF1a-Cre (2.1 x 1013 vg/ml ...
-
bioRxiv - Neuroscience 2024Quote: The coding sequences for Kir2.1-T2A-tdTomato and mutKir2.1-T2A-tdTomato (gifts from Massimo Scanziani, Addgene #60661 and #60644, respectively) were subcloned into an hSyn-DIO backbone ...
-
bioRxiv - Neuroscience 2024Quote: ... Templates for sgRNA synthesis were generated by PCR from a pX330 template (Addgene), sgRNAs were transcribed in vitro and purified (Megashortscript ...
-
bioRxiv - Neuroscience 2024Quote: ... psPAX2 (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID:Addgene_12260) and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-DIO-hM4D(Gi)-mCherry (Addgene viral prep # 44362AAV5 ...
-
bioRxiv - Neuroscience 2024Quote: ... pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (Addgene viral prep # 104492-AAV1; http://n2t.net/addgene:104492; RRID:Addgene_104492)34 ...
-
bioRxiv - Neuroscience 2024Quote: ... pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (Addgene viral prep # 104492-AAV1 ...
-
bioRxiv - Systems Biology 2024Quote: ... and ligating into pEN_TTmcs (Addgene, 25755) (107 ...
-
bioRxiv - Systems Biology 2024Quote: ... pSLIK CVB3 A67G hygro was prepared by Gateway recombination of pEN_TT CVB3 A67G (Addgene, 216788) and pSLIK hygro (Addgene ...