Labshake search
Citations for Addgene :
501 - 550 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... driven by a SFFV promoter (from plasmid #pFu-62 derived from Addgene Plasmid #57827 ...
-
bioRxiv - Molecular Biology 2024Quote: The expression vectors encoding truncated AlkB and AlkB D135S (13) pET30a-AlkB and pET30a-AlkB-D135S were a gift from Tao Pan (Addgene plasmid # 79051 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pET30a-AlkB and pET30a-AlkB-D135S were a gift from Tao Pan (Addgene plasmid # 79051; http://n2t.net/addgene:79051; RRID:Addgene_79051 ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Cell Biology 2024Quote: ... and pMD2.G plasmid (Addgene, Plasmid # 12259). The conditioned media was collected and filtered 48h post transfection and used to infect the Kdm4a-null MEFs using polybrene (Millipore Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... PAX2 plasmid (Addgene, Plasmid # 35002) and pMD2.G plasmid (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... the coding region of SERCA2b (Addgene, plasmid #75188 ...
-
bioRxiv - Microbiology 2024Quote: ... The two fragments upstream and downstream of the mfd gene were cloned at each side of the chloramphenicol cassette (CatR) from the pDK3 plasmid (Addgene) into the pUC57 vector (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... pN3-3×Flag-Control was purchased from Addgene (Watertown ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4–1026 bp for the N-terminus and 2578–4563 bp for the C-terminus) was subcloned into C-Flag-pcDNA3 (Addgene, plasmid # 20011 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 30 μg of envelope plasmid (VSV-G, Addgene #8454), and 30 μg of transfer plasmid using 270 μl of polyethylene imine (PEI) ...
-
bioRxiv - Molecular Biology 2024Quote: ... hfRfxCas13 constructs were subcloned from Addgene #190034 ...
-
bioRxiv - Microbiology 2024Quote: ... a gift from Didier Trono (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260), to generate lentiviral particles ...
-
bioRxiv - Molecular Biology 2024Quote: To generate RAD54L2 knockouts a double-stranded DNA oligo encoding a sgRNA targeting the RAD54L2 5’ region from the TKOv3 library (Hart et al, 2017) (5’-AAGATGGGCAGCAGCCGCCG CGG–3’) was cloned into pSpCas9(BB)-2A-Puro (PX459) (RRID: Addgene_48139) to yield PX459-RAD54L2.
-
bioRxiv - Microbiology 2024Quote: ... 20ng encoding firefly luciferase driven by an IFN-beta promoter (IFN-Beta_pGL3, Addgene 102597), 5ng of renilla luciferase (pRL-TK - Promega E2241) ...
-
bioRxiv - Microbiology 2024Quote: ... which was then inserted between the KpnI and EcoRI sites of the pDG704 vector (Addgene). The constructed plasmid was named pKp002 and transformed into electro competent E ...
-
bioRxiv - Microbiology 2024Quote: ... and DS-SPCas (#48645, Addgene) plasmids was performed via complete plasmid amplification with the primers carrying the respective 5’-overhangs ...
-
bioRxiv - Cell Biology 2024Quote: ... CFP-CaaX and YFP-CaaX were gifts from Tobias Meyer (Addgene plasmids #155222 ...
-
bioRxiv - Cell Biology 2024Quote: ... CFP-CaaX and YFP-CaaX were gifts from Tobias Meyer (Addgene plasmids #155222, #155232, #155233;http://n2t.net/addgene:155222; RRID:Addgene_155222). For rescue experiments ...
-
bioRxiv - Microbiology 2024Quote: ... The insertion of the sgRNA sequences into pCPf1 (#122185, Addgene) and DS-SPCas (#48645 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bacterial clones expressing double-stranded RNA (dsRNA) included the control (empty vector pL4440) sourced from Addgene, Cambridge ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from Nico Dantuma (Addgene plasmid # 23971 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from David Sabatini (Addgene plasmid # 1864; http://n2t.net/addgene:1864; RRID:Addgene_1864),145 shRNA against DOT1L (CGCCAACACGAGTGTTATATT ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid for expression of EPS15-GFP-His was obtained from Addgene (#170860). EPS15D177S was generated using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: ... 11.25 μg psPAX2 (Addgene, 12260), and 3.75 μg pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... APMAPAD-KDEL (untagged) was made from TagBFP-KDEL (Addgene 49150) by replacing TagBFP between the ER signal sequence of BiP and KDEL ER retention signal with the ER-luminal portion of APMAP ...
-
bioRxiv - Microbiology 2024Quote: Gene deletions for BtΔsusCD and BoΔsusCD mutants were generated using counterselectable allelic exchange with pSIE1 (Addgene plasmid #136355) as described previously24 ...
-
bioRxiv - Cell Biology 2024Quote: ... a TEAD-reporter construct (8xGTIIC-luciferase, Addgene, Plasmid #34615) and a CMV-Renilla (pGL4.75[hRluc/CMV] ...
-
bioRxiv - Molecular Biology 2024Quote: ... the HEK293T cells were transfected with the respective constructs along with envelope plasmid (pMD2.G) (Addgene, Cat# 12259), and packaging plasmid (psPAX2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... C-terminally FLAG-tagged ASXL1 p.G646Wfs*12 and p.Y591X were obtained from Addgene. The MSCV-T2A-Puromycin vectors encoding 3xFLAG-tagged full-length ASXL1 and truncated ASXL1 were generated by PCR amplification followed by sub-cloning using Gibson assembly.
-
bioRxiv - Molecular Biology 2024Quote: ... and packaging plasmid (psPAX2) (Addgene, 12260) using Lipofectamine 3000 according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a non-targeting control (F: GCACTACCAGAGCTAACTCAGATAGTACT) were designed using the BROAD Institute design tool and cloned into pLKO.1 vector (Addgene, Cat# 8453), followed by validating the successful insertions using Colony-PCR and Sanger sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... They were cloned into lentiCRISPR-v2 (Addgene, Cat# 52961) following the GeCKO protocol with slight modifications64 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCBASceI plasmid (1.5 µg) (Addgene, 26477)(55) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then cloned into pWPXL vector (Addgene #12257) generating pwpxl-tsTE1 plasmid for overexpression assay in vitro.
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene: 52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... TCOF1-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid # 129716) using In-Fusion cloning ...
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Cell Biology 2024Quote: ... and pmGFP-P2A-K20-P2A-RFP (Addgene #105688) have been described previously 36.
-
bioRxiv - Molecular Biology 2024Quote: ... BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Molecular Biology 2024Quote: ... BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Cell Biology 2024Quote: ... These two plasmids were co-electroporated with a plasmid encoding the sgRNA for the gene locus (Supplementary Table 2, Addgene #47108 ...
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders ...
-
bioRxiv - Molecular Biology 2024Quote: ... To generate Ogt iKO mESC carrying the 2C-reporter we used the MERVL::tdTomato reporter [51] that was kindly shared from Samuel Pfaff (Addgene #40281). Reporter stable cell line was generated by transfection (Lipofectamine™ 2000 ...
-
bioRxiv - Cell Biology 2024Quote: ... pMDL (Addgene, #12251), and either the tetracycline transactivator (TTA ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293T cells were transfected with the DNA of lentiviral packaging plasmids vSVG (Addgene, USA, #8454), RSV (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... These plasmids and their sequence information are available from Addgene. Cell lines
-
bioRxiv - Cell Biology 2024Quote: ... GFP-OMP25 was a gift of Gia Voeltz (Addgene 141150). BFP-OMP25 and mCherry- OMP25 were generated by cloning the OMP25 cassette from GFP-OMP25 into the XhoI/BamHI sites of pTagBFP-C and pmCherry-C1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Halo-MTS (referred to as mito-HaloTag; a gift of Jin Wang; Addgene 124315) and mito-mCherry (Kumar et al. ...