Labshake search
Citations for Addgene :
551 - 600 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Genetics 2024Quote: ... γcry1:BFP vector (Addgene #117789) with primers Ori-F and 2A-R (35 ...
-
bioRxiv - Neuroscience 2024Quote: ... and hOPTNΔC (Addgene, #23053) were cloned into meGFP-hTRAK1 to generate meGFP-hOPTN and meGFP- hOPTNΔC ...
-
bioRxiv - Neuroscience 2024Quote: ... TRAK1 (Addgene, #127621), his-hOPTN (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... 4xmts-mScarlet-I (Addgene, #98818), TurboID (Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: ... Lentiviral packaging vectors were obtained from Addgene and included pMDLg/pRRE (plasmid 12251) ...
-
bioRxiv - Neuroscience 2024Quote: ... TurboID (Addgene, #107169) and Cre 33 were cloned and packaged into our pAM-AAV- mSncg-WPRE backbone containing the RGC-specific full-length mSncg promoter 33 ...
-
bioRxiv - Microbiology 2024Quote: ... a 350-450 bp fragment corresponding to the U16 sequence was cloned into the double T7 vector L4440 (a gift from Andrew Fire, Addgene plasmid # 1654). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... We acquired wild-type α-syn/pET21a (Addgene 51486) courtesy of the Michael J ...
-
bioRxiv - Microbiology 2024Quote: ... The Ebola GP-encoding plasmid was obtained from Addgene. Information about RBPs is provided in Table S1.
-
bioRxiv - Microbiology 2024Quote: ... Guide RNAs targeting exon 6 of Akr1c13 were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230). A T7-sgRNA PCR product was amplified and in vitro transcribed as previously described (65 ...
-
bioRxiv - Molecular Biology 2024Quote: Lentiviruses were produced in HEK293FT cells cultured in T225 flasks by cotransfection of 30μg of packaging plasmid (psPAX2, Addgene #12260), 30 μg of envelope plasmid (VSV-G ...
-
bioRxiv - Microbiology 2024Quote: ... a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n was a gift from Wenbiao Chen (Addgene plasmid #47929; http://n2t.net/addgene:47929; RRID: Addgene_47929). pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542 ...
-
bioRxiv - Molecular Biology 2024Quote: The plasmid pLVX-EF1alpha-SARS-CoV-2-orf6-2xStrep-IRES-Puro (Addgene plasmid #141387 from Nevan Krogan) [12] was used for the overexpression of the accessory proteins ORF6 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542 ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP-BLM is from Addgene plasmid #80070 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n was a gift from Wenbiao Chen (Addgene plasmid #47929 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542; http://n2t.net/addgene:62542; RRID: Addgene_62542). 250 ng/μl of Cas9 mRNA and 50 ng/μl of gRNA(s ...
-
bioRxiv - Molecular Biology 2024Quote: ... and full-length mTagBFP2 in Puc19 (Addgene Plasmid #50005), driven by a SFFV promoter (from plasmid #pFu-62 derived from Addgene Plasmid #57827 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a WPRE sequence in pLentiGuide-Puro (Addgene Plasmid #52963), driven by the EF1a promoter ...
-
bioRxiv - Molecular Biology 2024Quote: ... driven by a SFFV promoter (from plasmid #pFu-62 derived from Addgene Plasmid #57827 ...
-
bioRxiv - Molecular Biology 2024Quote: The expression vectors encoding truncated AlkB and AlkB D135S (13) pET30a-AlkB and pET30a-AlkB-D135S were a gift from Tao Pan (Addgene plasmid # 79051 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pET30a-AlkB and pET30a-AlkB-D135S were a gift from Tao Pan (Addgene plasmid # 79051; http://n2t.net/addgene:79051; RRID:Addgene_79051 ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Cell Biology 2024Quote: ... and pMD2.G plasmid (Addgene, Plasmid # 12259). The conditioned media was collected and filtered 48h post transfection and used to infect the Kdm4a-null MEFs using polybrene (Millipore Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... PAX2 plasmid (Addgene, Plasmid # 35002) and pMD2.G plasmid (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... the coding region of SERCA2b (Addgene, plasmid #75188 ...
-
bioRxiv - Microbiology 2024Quote: ... The two fragments upstream and downstream of the mfd gene were cloned at each side of the chloramphenicol cassette (CatR) from the pDK3 plasmid (Addgene) into the pUC57 vector (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... pN3-3×Flag-Control was purchased from Addgene (Watertown ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4–1026 bp for the N-terminus and 2578–4563 bp for the C-terminus) was subcloned into C-Flag-pcDNA3 (Addgene, plasmid # 20011 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 30 μg of envelope plasmid (VSV-G, Addgene #8454), and 30 μg of transfer plasmid using 270 μl of polyethylene imine (PEI) ...
-
bioRxiv - Molecular Biology 2024Quote: ... hfRfxCas13 constructs were subcloned from Addgene #190034 ...
-
bioRxiv - Microbiology 2024Quote: ... a gift from Didier Trono (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260), to generate lentiviral particles ...
-
bioRxiv - Molecular Biology 2024Quote: To generate RAD54L2 knockouts a double-stranded DNA oligo encoding a sgRNA targeting the RAD54L2 5’ region from the TKOv3 library (Hart et al, 2017) (5’-AAGATGGGCAGCAGCCGCCG CGG–3’) was cloned into pSpCas9(BB)-2A-Puro (PX459) (RRID: Addgene_48139) to yield PX459-RAD54L2.
-
bioRxiv - Microbiology 2024Quote: ... 20ng encoding firefly luciferase driven by an IFN-beta promoter (IFN-Beta_pGL3, Addgene 102597), 5ng of renilla luciferase (pRL-TK - Promega E2241) ...
-
bioRxiv - Microbiology 2024Quote: ... which was then inserted between the KpnI and EcoRI sites of the pDG704 vector (Addgene). The constructed plasmid was named pKp002 and transformed into electro competent E ...
-
bioRxiv - Microbiology 2024Quote: ... and DS-SPCas (#48645, Addgene) plasmids was performed via complete plasmid amplification with the primers carrying the respective 5’-overhangs ...
-
bioRxiv - Cell Biology 2024Quote: ... CFP-CaaX and YFP-CaaX were gifts from Tobias Meyer (Addgene plasmids #155222 ...
-
bioRxiv - Cell Biology 2024Quote: ... CFP-CaaX and YFP-CaaX were gifts from Tobias Meyer (Addgene plasmids #155222, #155232, #155233;http://n2t.net/addgene:155222; RRID:Addgene_155222). For rescue experiments ...
-
bioRxiv - Microbiology 2024Quote: ... The insertion of the sgRNA sequences into pCPf1 (#122185, Addgene) and DS-SPCas (#48645 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bacterial clones expressing double-stranded RNA (dsRNA) included the control (empty vector pL4440) sourced from Addgene, Cambridge ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from Nico Dantuma (Addgene plasmid # 23971 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from David Sabatini (Addgene plasmid # 1864; http://n2t.net/addgene:1864; RRID:Addgene_1864),145 shRNA against DOT1L (CGCCAACACGAGTGTTATATT ...
-
bioRxiv - Cell Biology 2024Quote: Sox2se-CPG-TV-dTomatto and Gapdh-CpG-TV-GFP plasmids (Addgene plasmid # 70155, and 70148) were a gift from Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid for expression of EPS15-GFP-His was obtained from Addgene (#170860). EPS15D177S was generated using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: ... 11.25 μg psPAX2 (Addgene, 12260), and 3.75 μg pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... APMAPAD-KDEL (untagged) was made from TagBFP-KDEL (Addgene 49150) by replacing TagBFP between the ER signal sequence of BiP and KDEL ER retention signal with the ER-luminal portion of APMAP ...
-
bioRxiv - Microbiology 2024Quote: Gene deletions for BtΔsusCD and BoΔsusCD mutants were generated using counterselectable allelic exchange with pSIE1 (Addgene plasmid #136355) as described previously24 ...
-
bioRxiv - Cell Biology 2024Quote: ... a TEAD-reporter construct (8xGTIIC-luciferase, Addgene, Plasmid #34615) and a CMV-Renilla (pGL4.75[hRluc/CMV] ...