Labshake search
Citations for Addgene :
1701 - 1750 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Beta (Addgene # 170449), Gamma (Addgene # 170450) ...
-
bioRxiv - Genetics 2024Quote: ... Gamma (Addgene # 170450), Delta (Addgene # 172320) ...
-
bioRxiv - Genetics 2024Quote: ... Delta (Addgene # 172320), or Omicron BA1 (Addgene # 179907 ...
-
bioRxiv - Genetics 2024Quote: ... or Omicron BA1 (Addgene # 179907) spikes ...
-
bioRxiv - Genetics 2024Quote: ... 1 μg of the lentiviral transfer vector G1088E_pLenti-CMV-mNeonGreen-2A-HygroR (Addgene #216279), and 1 μg of one of six spike proteins tested.
-
bioRxiv - Genetics 2024Quote: ... or the Alpha (Addgene # 170451), Beta (Addgene # 170449) ...
-
bioRxiv - Genetics 2024Quote: ... derived from the LLP-Int-BFP-IRES-iCasp9-Blast construct (Addgene plasmid #171588), was described previously[3] ...
-
bioRxiv - Genetics 2024Quote: ... The Lenti-iCas9-Neo vector containing the Flag-iCas9-P2A-GFP cassette for Cas9 expression in K562 cells was obtained as a gift from Qin Yan (Addgene plasmid #85400,35). For Cas9 expression in HEK293T cells ...
-
bioRxiv - Microbiology 2024Quote: ... using an engineered plasmid that encodes a deGFP protein and a malachite green RNA aptamer (PT7-deGFP-MGapt was a gift from Richard Murray, via Addgene plasmid # 67741 ...
-
bioRxiv - Microbiology 2024Quote: ... coli MG-1655 cells harboring the pEB1-mGFPmut2 plasmid where used throughout the study (pEB1-mGFPmut2 was a gift from Philippe Cluzel, Addgene plasmid #103980 ...
-
bioRxiv - Genetics 2024Quote: ... Constructs were transfected into 293FT cells together with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Genetics 2024Quote: Our custom CRISPRi library was constructed using pAX198 (Addgene #173042) that includes pU6-sgRNA-EF1a-Puro-T2A-BFP ...
-
bioRxiv - Genetics 2024Quote: ... Transfection was carried out with psPAX2 (Addgene #12260), pMD2.G Addgene #12259) ...
-
bioRxiv - Genetics 2024Quote: HeLa CRISPRi cells were generated by lentiviral integration (∼3 to 5 MOI) using the dCas9-KRAB-blast plasmid (Addgene #89567), followed by single cell isolation ...
-
bioRxiv - Genetics 2024Quote: The IS621 recombinase gene was human codon optimized and cloned into a modified pFastBac expression vector (Addgene, Item ID: 30115), which includes an N-terminal His6-tag ...
-
bioRxiv - Genetics 2024Quote: A CRIPSR guide for the SCN5A E171Q mutation was designed using the CRISPOR online tool.20 We cloned the guide sequence (AATCTTGACCAGAGACTCAA-AGG) into SpCas9-2A-GFP (pX458, Addgene #48138)21 by annealing complementary primers 5’CACCGAATCTTGACCAGAGACTCAA and 5’AAACTTGAGTCTCTGGTCAAGATTC ...
-
bioRxiv - Genetics 2024Quote: ... while pRS418 (Addgene plasmid #11256) was used to amplify the clonNAT cassette and also was the vector of choice for Gibson assembly cloning methodology for the promoter/allele swap experiments.
-
bioRxiv - Genomics 2024Quote: ... flanking the region of interest were designed using CRISPOR (http://crispor.tefor.net/) to be further introduced either into pX458 or pX459 vectors from Addgene (each vector contains one gRNA). pX458 and pX459 vectors were previously digested 2hours at 37°C by BbsI (NEB ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas929 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we co-transformed them with a pCAS plasmid (Addgene) targeting the HPH marker and the eGFP sequence with homology arms for each locus50 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas9 with the PCR amplified MYO3 and MYO5 SH3 single position mutated libraries from the pUC19 preparations acting as the donor DNA29 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we first replaced the SH3 domain with a flexible linker (GGSSGGGG) using yeast competent cells that were co-transformed with a pCAS plasmid (Addgene plasmid 60847) expressing both the gRNA of interest and Streptococcus pyogenes Cas9 and a donor DNA sequence (stuffer ...
-
bioRxiv - Genetics 2024Quote: All annealed sgRNA oligos were subcloned into a Cas9 expression plasmid (lentiCRISPR v2, Addgene, #52961, a gift from Feng Zhang) with the Bsmb1 site ...
-
bioRxiv - Genetics 2024Quote: ... The plasmid pHR-UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB was a gift from Mikko Taipale (Addgene plasmid #154473). CRISPRi RPTEC cell line was verified by monitoring mCherry fluorescence over several generations ...
-
bioRxiv - Genetics 2024Quote: ... and pMD2.G (Addgene, #12259, a gift from Didier Trono), using polyethylenimine (PEI ...
-
bioRxiv - Genetics 2024Quote: ... pPAX2 (Addgene, #12260, a gift from Didier Trono) and pMD2.G (Addgene ...
-
bioRxiv - Genetics 2024Quote: ... annealed sgRNA oligos were subcloned into LRG2.1 (Addgene #108098, a gift from Christopher Vakoc) with the Bsmb1 site ...
-
bioRxiv - Genetics 2024Quote: ... a kind gift from Jonathan Weissman (Addgene #60955) (Gilbert et al ...
-
bioRxiv - Genetics 2024Quote: ... using 3 µg of pCAG-NLS-HA-Bxb1 plasmid (a kind gift from Pawel Pelczar (Addgene plasmid #51271) (Hermann et al ...
-
bioRxiv - Genomics 2024Quote: ... with either UniSAM empty vector (Addgene #99866) or UniSAM vector containing sgRNA targeting LEPR AFE2 promoter region (3 replicates per condition)48 ...
-
bioRxiv - Genomics 2024Quote: ... we used a SaCas9 and GFP-containing backbone (Addgene #118836, plasmid pTRI211) into which was cloned the SaCas9-CTG sgRNA to give plasmid pTRI 212.
-
bioRxiv - Genomics 2024Quote: ... the left TALEN arm was cloned into pHR’CMVGFP_hRIF1(1924- 2446)IREShygro3 (Addgene #23138) to give plasmid pTRI204 ...
-
bioRxiv - Genomics 2024Quote: ... The left recoded arm was cloned in pHR’CMVGFP_hRIF1(1924-2446)IREShygro3 (Addgene #23138) at BamHI and XhoI to give plasmid pTRI213 ...
-
bioRxiv - Genetics 2024Quote: ... pCMV_ABEmax_P2A_GFP (Addgene plasmid # 112101) was a gift from David Liu ...
-
bioRxiv - Genetics 2024Quote: ... and pMD2.G (Addgene plasmid # 12259) were a gift from Didier Trono ...
-
bioRxiv - Genetics 2024Quote: ... MLM3636 (Addgene plasmid # 43860) was a gift from Keith Joung ...
-
bioRxiv - Genetics 2024Quote: ... pDT-sgRNA (Addgene# 138271) vector was selected as gRNA carrier ...
-
bioRxiv - Genomics 2024Quote: ... the expression plasmids (pRha-ABE8e-NRCH, Addgene #165417; and pABE8e-protein, Addgene #161788) were transformed into BL21Start DE3 competent cells (Thermo) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The pUC18R6K-mini-Tn7T-Gm plasmid [31] was a gift from Herbert Schweizer (Addgene plasmid # 65022; http://n2t.net/addgene:65022; RRID:Addgene_65022) The pFLP3 plasmid (Addgene #64946 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The pUC18R6K-mini-Tn7T-Gm plasmid [31] was a gift from Herbert Schweizer (Addgene plasmid # 65022 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The pFLP3 plasmid (Addgene #64946, [32]) was then introduced by conjugation to remove the FRT-flanked gentamicin resistance marker by FLP recombination ...
-
bioRxiv - Genomics 2024Quote: ... an intermediate backbone plasmid (pJY126) was first generated by removing BsmBI restriction sites on pU6-sgRNA-EF1Alpha-puro-T2A-BFP (Addgene #60955)35 through Golden Gate Assembly (NEB E1602S) ...
-
bioRxiv - Genomics 2024Quote: ... the expression plasmids (pRha-ABE8e-NRCH, Addgene #165417 ...
-
bioRxiv - Genomics 2024Quote: Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). Cloning of dCas9 expression plasmid (lenti-dCas9-Blast ...
-
bioRxiv - Genomics 2024Quote: ... respectively),25 modified scaffold sequence was 5′GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGC,60 and RNA structural motif for epegRNAs was tevopreQ1 (5′-CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA).40 pegRNAs and epegRNAs used the pU6-sgRNA-EF1Alpha-puro-T2A-BFP (Addgene #60955)35 backbone ...
-
bioRxiv - Genomics 2024Quote: ... Lenti_gRNA-Puro (Addgene #84752). The dual-pegRNA lentiviral vector ...
-
bioRxiv - Genomics 2024Quote: ... a lentiviral vector was prepared by PCR amplification of the corresponding cassettes from pCMV-PEmax-P2A-hMLH1dn and subsequent insertion into pLenti-PE2-BSD (Addgene #161514), which had been digested with EcoRI and XbaI (#R0145S & #R3101S ...
-
bioRxiv - Genomics 2024Quote: ... The pU6_pegRNA-GG-Acceptor plasmid (Addgene #132777) was modified to exchange the mRFP1 cassette with a BsmBI cloning cassette ...
-
bioRxiv - Genomics 2024Quote: For transient co-expression of PEmax and MLH1dn we used the pCMV-PEmax-P2A-hMLH1dn plasmid (Addgene #174828). The pU6_pegRNA-GG-Acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Genomics 2024Quote: ... and 6 were generated from pSpCas9(BB)-2A-Puro (PX459 V2.0, Addgene #62988) via insertion of spacer sequences into the BbsI cloning site (#R3539L ...