Labshake search
Citations for Addgene :
1701 - 1750 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... or Omicron BA1 (Addgene # 179907) spikes ...
-
bioRxiv - Genetics 2024Quote: ... 1 μg of the lentiviral transfer vector G1088E_pLenti-CMV-mNeonGreen-2A-HygroR (Addgene #216279), and 1 μg of one of six spike proteins tested.
-
bioRxiv - Genetics 2024Quote: ... or the Alpha (Addgene # 170451), Beta (Addgene # 170449) ...
-
bioRxiv - Genetics 2024Quote: ... derived from the LLP-Int-BFP-IRES-iCasp9-Blast construct (Addgene plasmid #171588), was described previously[3] ...
-
bioRxiv - Developmental Biology 2024Quote: ... PB-TRE3G-SOX17 was a gift from David Vereide (Addgene plasmid # 104541 ...
-
bioRxiv - Developmental Biology 2024Quote: ... PB-TRE3G-SOX17 was a gift from David Vereide (Addgene plasmid # 104541 ; http://n2t.net/addgene:104541 ; RRID:Addgene_104541) Sox17 and sox32 deletion and domain switch constructs (Table S1 ...
-
bioRxiv - Genetics 2024Quote: ... we interrupted the mCHERRY ORF of pGH044 (Addgene Plasmid #85412, RRID: Addgene_85412). We scanned mCHERRY for “AGGT” stretch and placed the intron between the AG and GT ...
-
bioRxiv - Genetics 2024Quote: ... we interrupted the mCHERRY ORF of pGH044 (Addgene Plasmid #85412, RRID: Addgene_85412). We scanned mCHERRY for “AGGT” stretch and placed the intron between the AG and GT ...
-
bioRxiv - Developmental Biology 2024Quote: ... pyogenes Cas9 under the expression of CAGC promoter) was a gift from Marianne Bronner (Addgene plasmid # 99138; http://n2t.net/addgene:99138; RRID: Addgene_99138). Tol2-U6.3-sgRNA-GFP was made by VectorBuilder expressing within a Tol2 transposon a cytoplasmic GFP reporter under the control of GAGC promoter and sgRNA guide expressed under chick specific U6.3 promoter ...
-
bioRxiv - Developmental Biology 2024Quote: pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3 was purchased from Addgene (112007). Full-length cDNA of GCaMP6s was PCR-amplified:
-
bioRxiv - Developmental Biology 2024Quote: pCAGG-NLS-Cas9-NLS (expressing nuclear localised S. pyogenes Cas9 under the expression of CAGC promoter) was a gift from Marianne Bronner (Addgene plasmid # 99138 ...
-
bioRxiv - Genetics 2024Quote: ... We next used the Gateway™ LR Clonase™ II Enzyme mix to recombine each of the four PCR products into the pBID-UASC-G backbone (Addgene Plasmid #35202), which contains a φC31 integrase compatible attB sequence and UAS binding sites for the GAL4 expression system (Wang et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... pX330-SpCas9-HF1 was a gift from Yuichiro Miyaoka (Addgene plasmid#108301;http://n2t.net/addgene:108301; RRID:Addgene_108301) Sequences were confirmed via Sanger sequencing ...
-
bioRxiv - Developmental Biology 2024Quote: ... pX330-SpCas9-HF1 was a gift from Yuichiro Miyaoka (Addgene plasmid#108301;http://n2t.net/addgene:108301 ...
-
bioRxiv - Developmental Biology 2024Quote: The TIR-gRNA sequence was cloned into the pU6-BbsI-chiRNA plasmid (Addgene #45946) using the FlyCRISPR protocol (Port et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... The entire hairpin sequence was then inserted into the vector pHyVec12 (Addgene plasmid #51851 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1128 base pairs of HyNotch-NICD (1648-2775 of Notch mRNA) was inserted into the vector pHyVec11 (Addgene plasmid #34794) and was driven by the Hydra actin promoter ...
-
bioRxiv - Developmental Biology 2024Quote: ... The WT line was derived from a WTC11-LaminB subclone that was exposed to a TBXT sgRNA (CAGAGCGCGAACTGCGCGTG; a gift from Jacob Hanna (Addgene plasmid #5972)) but remained unedited ...
-
bioRxiv - Developmental Biology 2024Quote: ... and pCFJ104 (Addgene Plasmid #19328) at 2.5 ng/µL and 5 ng/µL concentrations respectively ...
-
bioRxiv - Developmental Biology 2024Quote: ... in the canal was generated by microinjection of plasmid pWD285 at 10 ng/µL concentration with coinjection markers pCFJ90 (Addgene Plasmid #19327) and pCFJ104 (Addgene Plasmid #19328 ...
-
bioRxiv - Developmental Biology 2024Quote: Oligos of designed gRNA sequences were cloned into lentiCRISPRv2 (Addgene #52961) following previously published protocol35 ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Genetics 2024Quote: ... containing BrdU cassette obtained from Addgene (Addgene plasmid # 71789-71792), were integrated at four different auxotrophic loci (HIS3 ...
-
bioRxiv - Genetics 2024Quote: ... pML104 was a gift from John Wyrick (Addgene plasmid # 67638)(Laughery et al ...
-
bioRxiv - Developmental Biology 2024Quote: Plasmid pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene, plasmid #42335; Cong et al., 2013) was used to synthesize DNA templates containing the single guide (sg)RNA scaffold ...
-
bioRxiv - Developmental Biology 2024Quote: ... USA) or GENEWIZ from Azenta Life Sciences (South Plainfield, NJ, USA) and subsequently cloned upstream of a H2B-mCerulean (Addgene #198059). Promoter activity was scored by microinjecting 25ng/μl of circular plasmid and screening for fluorescence in embryos 24 hours post fertilization (hpf) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The Minos transposase (pBlueSKMimRNA) plasmid was a gift from Michalis Averof (Addgene plasmid #102535). The piggyBac transposase (pT7mRNA-PB transposase ...
-
bioRxiv - Developmental Biology 2024Quote: ... and envelope pMD2.G (Addgene #12259) plasmids into 293T packaging cells (ATCC) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The pDEST-CMV-N-Tandem-mCherry-EGFP plasmid was a gift from Robin Ketteler (Addgene plasmid #123216; http://n2t.net/addgene:123216; RRID:Addgene_123216) (Agrotis and Ketteler ...
-
bioRxiv - Developmental Biology 2024Quote: ... The pDEST-CMV-N-Tandem-mCherry-EGFP plasmid was a gift from Robin Ketteler (Addgene plasmid #123216 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The sgRNAs were sub-cloned into the pX459 plasmid from Addgene, with 8 μg of each vector utilized for the transfection of mESCs ...
-
bioRxiv - Developmental Biology 2024Quote: ... pCAG-myr-mRFP (Addgene #32604), or pCAG-DeAct-SpvB (a fusion protein of DeAct-SpvB with EGFP ...
-
bioRxiv - Developmental Biology 2024Quote: ... or pCAG-DeAct-SpvB (a fusion protein of DeAct-SpvB with EGFP, subcloned into pCAG from Addgene #89446) plasmids to 3.5 µg/µL in molecular grade ddH2O with 5% sucrose and 0.1% Fast Green FCF ...
-
bioRxiv - Developmental Biology 2024Quote: ... Guide sequences were inserted into the Cas9–sgRNA plasmid (pDD162, Addgene #47549) using the NEB Q5 Site-Directed Mutagenesis Kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... The HDR plasmid containing ippk-1 homology arms and the GFP and selection cassette (pDD282, Addgene #66823) was made using Gibson Assembly as described in Dickinson et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the VSV-G envelope expressing plasmid pMD2.G (gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Developmental Biology 2024Quote: ... the third generation lentiviral pHAGE vector originally developed in the lab of Richard Mulligan86 was used together with the second generation lentiviral packaging plasmid psPAX2 (gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the VSV-G envelope expressing plasmid pMD2.G (gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... pCAG-EGFP-CAAX (Addgene #86056), pCAG-myr-mRFP (Addgene #32604) ...
-
bioRxiv - Developmental Biology 2024Quote: ... the third generation lentiviral pHAGE vector originally developed in the lab of Richard Mulligan86 was used together with the second generation lentiviral packaging plasmid psPAX2 (gift from Didier Trono (Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260)) and the VSV-G envelope expressing plasmid pMD2.G (gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Developmental Biology 2024Quote: ... a linker and an overhang in the coding sequence for mKate in plasmid pCFJ350 (Addgene) (grl-26+mKate_F ATGGAAATATATAATCGAAATTTTTCCTTTTTTGTAGAATCCCTTCCACTATTCCATCAAACA TGATTCAGCATACTGCGGAGCACGGAATGGTTCTCATTATTGTCAGGCATTTGCGATAGG AGCATCGGGAGCCTCAGGAGCATCGatgtccgagctcatcaaggagaacatg ...
-
bioRxiv - Genetics 2024Quote: ... The nCas9n cDNA was amplified from the expression vector pT3TS-nCas9n (Addgene #46757) with primers Cas9-F and Cas9-R (69) ...
-
bioRxiv - Genetics 2024Quote: ... containing BrdU cassette obtained from Addgene (Addgene plasmid # 71789-71792), were integrated at four different auxotrophic loci (HIS3 ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse Hoxa5 and Scip cloned into the pcDNA3.1 vector were used to amplify Hoxa5 and Scip and inserted into pCAG-tdTomato (Addgene, Cat #83029), a vector with the chick β-actin promoter/CMV enhancer ...
-
bioRxiv - Genetics 2024Quote: ... a kind gift from Mikko Taipale (Addgene plasmid #154473) (Alerasool et al ...
-
bioRxiv - Genetics 2024Quote: ... a kind gift from John Pringle (Addgene plasmid# 41597) (Choe et al ...
-
bioRxiv - Genetics 2024Quote: ... a kind gift from Mikko Taipale (Addgene plasmid #154473) (Alerasool et al ...
-
bioRxiv - Immunology 2024Quote: The plasmid pHIV-EGFP was gifted by Bryan Welm and Zena Werb (Addgene plasmid #21373), and pMD2.G and psPAX2 were gifted by Didier Trono (Addgene plasmid #12259 and #12260) ...
-
bioRxiv - Immunology 2024Quote: ... and pMD2.G and psPAX2 were gifted by Didier Trono (Addgene plasmid #12259 and #12260). To generate second-generation IL13Rα2 CAR-EGFP plasmid ...
-
bioRxiv - Genetics 2024Quote: ... was a gift from Shinya Yamanaka (Addgene plasmid # 41856 ...