Labshake search
Citations for Addgene :
1751 - 1800 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... mycBioID2-pBABE-puro was a gift from Kyle Roux (Addgene plasmid #80900 ...
-
bioRxiv - Cell Biology 2024Quote: ... The pX459-sfCherry CRISPR-Cas9 vector were generated from pSpCas9(BB)-2A-Puro (pX459) V2.0 (Addgene plasmid # 62988 ...
-
bioRxiv - Cell Biology 2024Quote: ... The GCN4 probe was pHR-scFv-GCN4-sfGFP-GB1-dWPRE (#60907, Addgene, USA). The above plasmids were assembled with the corresponding purified PCR fragments via Gibson Assembly kit ...
-
bioRxiv - Cell Biology 2024Quote: ... and the CIBN was amplified from CIBN-CAAX (#79574, Addgene, USA). The mCherry-CRY2 was amplified as described previously ...
-
bioRxiv - Cell Biology 2024Quote: The PI4P sensor based on optically-controlled phase separation was created by fusion of P4M domian from mCherry-P4M-SidM (#51471, Addgene, USA) to mGFP-CIBN ...
-
bioRxiv - Cell Biology 2024Quote: ... pMD2.G was a gift from Didier Trono (RRID:Addgene_12259), and psPAX2 was a gift from Didier Trono (RRID:Addgene_12260) ...
-
bioRxiv - Cell Biology 2024Quote: ... pLentiPGK Puro DEST ERKKTRClover was a gift from Markus Covert (RRID:Addgene_90227), pMD2.G was a gift from Didier Trono (RRID:Addgene_12259) ...
-
bioRxiv - Cell Biology 2024Quote: ... and psPAX2 was a gift from Didier Trono (RRID:Addgene_12260). Virus was harvested from day 2 to day 5 post-transfection by medium collection and centrifugation at 500×g at 4°C for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... The CRISPR-assisted insertion tagging system (CRISPaint) 8 plasmid (pCRISPR-HOT-Clover- BlastR) was obtained from Addgene (Plasmid #138569 ...
-
bioRxiv - Cell Biology 2024Quote: ... Transient expression of CMV-GFP-NMHC-IIA (Addgene #11347) and mCherry-MyosinIIB-N-18 (Addgene #55107 ...
-
bioRxiv - Cell Biology 2024Quote: ... the BamHI-NotI fragment from GAKdY (55) was ligated into the BamHI-NotI backbone of tdEOS-paxillin-22 (plasmid #57653; Addgene), replacing the tdEOS sequence to produce plasmid paxillin-GAKdy ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP-Tensin3 (catalog #105299) was purchased from Addgene.
-
bioRxiv - Cell Biology 2024Quote: The pLKO.1 – TRC cloning vector was a gift from David Root (Addgene plasmid # 10878; http://n2t.net/addgene:10878 ; RRID:Addgene_10878). The shRNA sequences were cloned into the AgeI and EcoRI sites of the plasmid using standard cloning techniques ...
-
bioRxiv - Cancer Biology 2024Quote: ... a gift from Feng Zhang (Addgene plasmid # 52961; http://n2t.net/addgene:52961; RRID: Addgene_52961). Lentiviral particles were produced through the transfection of the transfer plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... the mApple-Alpha-V-Integrin-25 was a gift from Michael Davidson (Addgene plasmid # 54866 ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 (a gift from Didier Trono, Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID: Addgene_12260) and pCMV-VSV-G 24 (a gift from Bob Weinberg ...
-
bioRxiv - Cancer Biology 2024Quote: ... the mApple-Alpha-V-Integrin-25 was a gift from Michael Davidson (Addgene plasmid # 54866; http://n2t.net/addgene:54866; RRID: Addgene_54866), the pCX-EGFP beta5 integrin receptor 20 was a gift from Raymond Birge (Addgene plasmid # 14996 ...
-
bioRxiv - Cancer Biology 2024Quote: The Luc2TdTomato cassette was cloned from the pCDNA3.1(+)/Luc2-TdT plasmid (Addgene 32904 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Knockout cells generated in 293A and HeLa cells were created with pLentiCRISPRv2 (Addgene, #52961) containing indicated gRNAs (Figure 7-figure supplement 1) ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Biochemistry 2024Quote: ... expressing Cas9 nuclease and two gRNAs (see below for sequences) together with the CRIS-PITCh vector pX330S-2-PITCh (63670, Addgene), harboring the Lamin A microhomologies and GFP-Puro or GFP-Neo/Kan insertions ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were immortalized by transduction with a retrovirus expressing SV40 large T antigen from pBABE-puro largeTcDNA (Addgene plasmid # 14088; http://n2t.net/addgene:14088; RRID:Addgene_14088; a gift from William Hahn) as previously described (13) ...
-
bioRxiv - Cell Biology 2024Quote: ... fused with bGHpA amplified from LSL-Cas9-Rosa26TV (Addgene plasmid # 61408 ...
-
bioRxiv - Cancer Biology 2024Quote: ... a gift from Feng Zhang (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pCX-EGFP beta5 integrin receptor 20 was a gift from Raymond Birge (Addgene plasmid # 14996; http://n2t.net/addgene:14996; RRID:Addgene_14996). For ITGAV depletion ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pCMV-VSV-G 24 (a gift from Bob Weinberg, Addgene plasmid # 8454; http://n2t.net/addgene:8454; RRID: Addgene_8454), into the HEK293T cells by using the TransIT-Lenti transfection reagent (Mirus Bio) ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 (a gift from Didier Trono, Addgene plasmid # 12260 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pCMV-VSV-G 24 (a gift from Bob Weinberg, Addgene plasmid # 8454 ...
-
bioRxiv - Biochemistry 2024Quote: ... and pGEX-6P-1-INTS3-FL were gifts from Yuliang Wu (Addgene plasmids #128307 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pVSV-G was a gift from Bob Weinberg (Addgene plasmid #8454). The single guide RNA (sgRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... LentiV-cas9_puro and Lenti_sgRNA_EFS_GFP plasmids (Addgene #108100 and 65656, respectively) were gifts from Christopher Vakoc ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 was a gift from Didier Trono (Addgene plasmid #12260). pVSV-G was a gift from Bob Weinberg (Addgene plasmid #8454) ...
-
bioRxiv - Cell Biology 2024Quote: ... the human WT LZTR1 coding sequence was synthesized (Genewiz/Azenta Life Sciences) and subcloned in pcDNA3-HA-humanNEMO (gift from Kunliang Guan, Addgene plasmid #13512) by exchanging the NEMO coding sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... and mCherry-MyosinIIB-N-18 (Addgene #55107) was achieved using a Nucleofector II electroporator and the Cell Line Nucleofector Kit V (Lonza Biosciences) ...
-
bioRxiv - Cell Biology 2024Quote: ... EMTB-3XGFP was a gift from William Bement [29] (Addgene plasmid # 26741 ...
-
bioRxiv - Cell Biology 2024Quote: ... EMTB-3XGFP was a gift from William Bement [29] (Addgene plasmid # 26741 ; http://n2t.net/addgene:26741; RRID:Addgene 26741) For Lifeact-mEmerald (pLVSIN-EF1a-Lifeact-mEmerald-IRES-pur) ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ; http://n2t.net/addgene:54148 ; RRID:Addgene 54148) For protein depletion ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 (gift from Didier Trono; Addgene plasmid # 12260), and pMD2.G (gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2024Quote: ... was amplified and purified as directed by Addgene. Lentiviral particles were generated by transfecting HEK293T cells with the GeCKOv2 CRISPR Knockout Pooled Plasmid Library ...
-
bioRxiv - Cancer Biology 2024Quote: ... The Toronto KnockOut Library v3 (TKOv3) (90294) was from Addgene. The DNA Damage Response MKOv4 Library (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: (Addgene #10878) was used for shRNA constitutive knockdown in cancer cells ...
-
bioRxiv - Cancer Biology 2024Quote: (Addgene #158560) was used for doxycycline-inducible SOX9 overexpression ...
-
bioRxiv - Cancer Biology 2024Quote: Lentiviral transduction of shRNA targeting Hmox1 was completed following viral preparation using plasmids supplied by the La Jolla Institute for Immunology (Seq1: TRCN0000045250: ACAGTTGCTGTAGGGCTTTAT, Seq2: TRCN0000045251: CAACAAGGAGAGCCCAGTCTT) and gifted from Didier Trono (RRID:Addgene_12259, RRID:Addgene_12260). Aco1 was targeted using sequences from the Mission Database (Seq1 ...
-
bioRxiv - Cancer Biology 2024Quote: Lentiviral transduction of shRNA targeting Hmox1 was completed following viral preparation using plasmids supplied by the La Jolla Institute for Immunology (Seq1: TRCN0000045250: ACAGTTGCTGTAGGGCTTTAT, Seq2: TRCN0000045251: CAACAAGGAGAGCCCAGTCTT) and gifted from Didier Trono (RRID:Addgene_12259, RRID:Addgene_12260). Aco1 was targeted using sequences from the Mission Database (Seq1 ...
-
bioRxiv - Cancer Biology 2024Quote: pLenti.CAG.H2B.Dendra2.W was a gift from Rusty Lansford (Addgene plasmid #51005; RRID:Addgene_51005). N-cad WT or W161A mutated DNA were amplified by PCR from pCAG-Ncad WT or W161A-HA (Kon et al. ...
-
bioRxiv - Cancer Biology 2024Quote: pLenti.CAG.H2B.Dendra2.W was a gift from Rusty Lansford (Addgene plasmid #51005; RRID:Addgene_51005). N-cad WT or W161A mutated DNA were amplified by PCR from pCAG-Ncad WT or W161A-HA (Kon et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... After 32 hours cells were transfected with an equimolar mix of CK2α/β plasmid (Addgene; #27093) and the relevant MCAM tail variant ...
-
bioRxiv - Cancer Biology 2024Quote: ... DR8.2 (1 µg) packaging construct (Addgene #8455) and the PMD2.G (5 μg ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the PMD2.G (5 μg) envelope construct (Addgene # 12259) were added to the solution ...