Labshake search

1901 - 1950 of 10000+ citations since 2019

• Tolerance thresholds underlie responses to DNA damage during germline development

  Gloria Jansen, et al., bioRxiv - Developmental Biology 2024

  Quote: The TIR-gRNA sequence was cloned into the pU6-BbsI-chiRNA plasmid (Addgene #45946) using the FlyCRISPR protocol (Port et al. ...
• Genetic interference with HvNotch provides new insights into the role of the Notch-signalling pathway for developmental pattern formation in Hydra

  Qin Pan, et al., bioRxiv - Developmental Biology 2024

  Quote: ... The entire hairpin sequence was then inserted into the vector pHyVec12 (Addgene plasmid #51851 ...
• Genetic interference with HvNotch provides new insights into the role of the Notch-signalling pathway for developmental pattern formation in Hydra

  Qin Pan, et al., bioRxiv - Developmental Biology 2024

  Quote: ... 1128 base pairs of HyNotch-NICD (1648-2775 of Notch mRNA) was inserted into the vector pHyVec11 (Addgene plasmid #34794) and was driven by the Hydra actin promoter ...
• CDX2 dose-dependently influences the gene regulatory network underlying human extraembryonic mesoderm development

  Emily A. Bulger, et al., bioRxiv - Developmental Biology 2024

  Quote: ... The WT line was derived from a WTC11-LaminB subclone that was exposed to a TBXT sgRNA (CAGAGCGCGAACTGCGCGTG; a gift from Jacob Hanna (Addgene plasmid #5972)) but remained unedited ...
• MRCK-1 activates non-muscle myosin for outgrowth of a unicellular tube in Caenorhabditis elegans

  Evelyn M. Popiel, W. Brent Derry, bioRxiv - Developmental Biology 2024

  Quote: ... and pCFJ104 (Addgene Plasmid #19328) at 2.5 ng/µL and 5 ng/µL concentrations respectively ...
• MRCK-1 activates non-muscle myosin for outgrowth of a unicellular tube in Caenorhabditis elegans

  Evelyn M. Popiel, W. Brent Derry, bioRxiv - Developmental Biology 2024

  Quote: ... in the canal was generated by microinjection of plasmid pWD285 at 10 ng/µL concentration with coinjection markers pCFJ90 (Addgene Plasmid #19327) and pCFJ104 (Addgene Plasmid #19328 ...
• VEGF counteracts shear stress-determined arterial fate specification during capillary remodeling

  Dongying Chen, et al., bioRxiv - Developmental Biology 2024

  Quote: Oligos of designed gRNA sequences were cloned into lentiCRISPRv2 (Addgene #52961) following previously published protocol35 ...
• Multimodal Hox5 activity generates motor neuron diversity

  Ritesh KC, et al., bioRxiv - Developmental Biology 2024

  Quote: ... mouse Hoxa5 and Scip cloned into the pcDNA3.1 vector were used to amplify Hoxa5 and Scip and inserted into pCAG-tdTomato (Addgene, Cat #83029), a vector with the chick β-actin promoter/CMV enhancer ...
• Identifying the molecular basis for functional divergence of duplicated SOX factors controlling endoderm formation and left-right patterning in zebrafish

  Simaran Johal, et al., bioRxiv - Developmental Biology 2024

  Quote: ... PB-TRE3G-SOX17 was a gift from David Vereide (Addgene plasmid # 104541 ...
• Identifying the molecular basis for functional divergence of duplicated SOX factors controlling endoderm formation and left-right patterning in zebrafish

  Simaran Johal, et al., bioRxiv - Developmental Biology 2024

  Quote: ... PB-TRE3G-SOX17 was a gift from David Vereide (Addgene plasmid # 104541 ; http://n2t.net/addgene:104541 ; RRID:Addgene_104541) Sox17 and sox32 deletion and domain switch constructs (Table S1 ...
• Morphologically defined substages of tail morphogenesis in C. elegans males

  Karin Kiontke, et al., bioRxiv - Developmental Biology 2024

  Quote: ... a linker and an overhang in the coding sequence for mKate in plasmid pCFJ350 (Addgene) (grl-26+mKate_F ATGGAAATATATAATCGAAATTTTTCCTTTTTTGTAGAATCCCTTCCACTATTCCATCAAACA TGATTCAGCATACTGCGGAGCACGGAATGGTTCTCATTATTGTCAGGCATTTGCGATAGG AGCATCGGGAGCCTCAGGAGCATCGatgtccgagctcatcaaggagaacatg ...
• A zebrafish system for identifying genetic dependencies in melanocytes and melanoma

  Sarah Perlee, et al., bioRxiv - Genetics 2024

  Quote: ... The nCas9n cDNA was amplified from the expression vector pT3TS-nCas9n (Addgene #46757) with primers Cas9-F and Cas9-R (69) ...
• Sir2 and Fun30 regulate ribosomal DNA replication timing via Mcm helicase positioning and nucleosome occupancy

  Carmina Lichauco, et al., bioRxiv - Genetics 2024

  Quote: ... containing BrdU cassette obtained from Addgene (Addgene plasmid # 71789-71792), were integrated at four different auxotrophic loci (HIS3 ...
• SAM-DNMT3A, a strategy for induction of genome-wide DNA methylation, identifies DNA methylation as a vulnerability in ER-positive breast cancers

  Mahnaz Hosseinpour, et al., bioRxiv - Genetics 2024

  Quote: The following plasmids were obtained from Addgene; Plenti-EF1a-SPdCas9-DNMT3B-2A-Blast (dCas9-DNMT3B ...
• SAM-DNMT3A, a strategy for induction of genome-wide DNA methylation, identifies DNA methylation as a vulnerability in ER-positive breast cancers

  Mahnaz Hosseinpour, et al., bioRxiv - Genetics 2024

  Quote: ... pXPR502 (Addgene # 96923), pLenti-EF1a-SPdCas9-DNMT3A-2A-Blast (dCas9-DNMT3A ...
• SAM-DNMT3A, a strategy for induction of genome-wide DNA methylation, identifies DNA methylation as a vulnerability in ER-positive breast cancers

  Mahnaz Hosseinpour, et al., bioRxiv - Genetics 2024

  Quote: ... and 875ng of pMD2.G (Addgene#12259) in Opti-MEM (Thermo-Fisher#51985091 ...
• SAM-DNMT3A, a strategy for induction of genome-wide DNA methylation, identifies DNA methylation as a vulnerability in ER-positive breast cancers

  Mahnaz Hosseinpour, et al., bioRxiv - Genetics 2024

  Quote: ... pLenti-EF1a-SPdCas9-DNMT3A(E752A)-2A-Blast (dCas9-inactiveDNMT3A; Addgene# 71218) and pLentiGuide-Puro (Addgene#52963).
• SAM-DNMT3A, a strategy for induction of genome-wide DNA methylation, identifies DNA methylation as a vulnerability in ER-positive breast cancers

  Mahnaz Hosseinpour, et al., bioRxiv - Genetics 2024

  Quote: ... pHRdSV40-NLS-dCas9-24ξGCN4-v4-NLS-P2A-BFP-dWPRE (Addgene#60910), pEF1a-NLS-scFvGCN4-DNMT3a (Addgene#100941) ...
• SAM-DNMT3A, a strategy for induction of genome-wide DNA methylation, identifies DNA methylation as a vulnerability in ER-positive breast cancers

  Mahnaz Hosseinpour, et al., bioRxiv - Genetics 2024

  Quote: ... pCCL-PGK-SPdCas9-BFP-DNMT1(dCas9-DNMT1) (Addgene#66818) pHRdSV40-NLS-dCas9-24ξGCN4-v4-NLS-P2A-BFP-dWPRE (Addgene#60910) ...
• SAM-DNMT3A, a strategy for induction of genome-wide DNA methylation, identifies DNA methylation as a vulnerability in ER-positive breast cancers

  Mahnaz Hosseinpour, et al., bioRxiv - Genetics 2024

  Quote: ... Plenti-EF1a-SPdCas9-DNMT3B-2A-Blast (dCas9-DNMT3B) (Addgene#71217), pCCL-PGK-SPdCas9-BFP-DNMT1(dCas9-DNMT1 ...
• CROPseq-multi: a versatile solution for multiplexed perturbation and decoding in pooled CRISPR screens

  Russell T. Walton, Yue Qin, Paul C. Blainey, bioRxiv - Genomics 2024

  Quote: ... Lentiviral plasmids MD2.G (Addgene #12259), psPAX (Addgene #12260) ...
• Pseudotyped virus infection of multiplexed ACE2 libraries reveals SARS-CoV-2 variant shifts in receptor usage

  Nidhi Shukla, et al., bioRxiv - Genetics 2024

  Quote: ... mixed with 1 μg of PsPax2 (Addgene # 12260), 1 μg of the lentiviral transfer vector G1088E_pLenti-CMV-mNeonGreen-2A-HygroR (Addgene #216279) ...
• Pseudotyped virus infection of multiplexed ACE2 libraries reveals SARS-CoV-2 variant shifts in receptor usage

  Nidhi Shukla, et al., bioRxiv - Genetics 2024

  Quote: ... Beta (Addgene # 170449), Gamma (Addgene # 170450) ...
• Pseudotyped virus infection of multiplexed ACE2 libraries reveals SARS-CoV-2 variant shifts in receptor usage

  Nidhi Shukla, et al., bioRxiv - Genetics 2024

  Quote: ... Gamma (Addgene # 170450), Delta (Addgene # 172320) ...
• Pseudotyped virus infection of multiplexed ACE2 libraries reveals SARS-CoV-2 variant shifts in receptor usage

  Nidhi Shukla, et al., bioRxiv - Genetics 2024

  Quote: ... Delta (Addgene # 172320), or Omicron BA1 (Addgene # 179907 ...
• Pseudotyped virus infection of multiplexed ACE2 libraries reveals SARS-CoV-2 variant shifts in receptor usage

  Nidhi Shukla, et al., bioRxiv - Genetics 2024

  Quote: ... or Omicron BA1 (Addgene # 179907) spikes ...
• Pseudotyped virus infection of multiplexed ACE2 libraries reveals SARS-CoV-2 variant shifts in receptor usage

  Nidhi Shukla, et al., bioRxiv - Genetics 2024

  Quote: ... 1 μg of the lentiviral transfer vector G1088E_pLenti-CMV-mNeonGreen-2A-HygroR (Addgene #216279), and 1 μg of one of six spike proteins tested.
• Pseudotyped virus infection of multiplexed ACE2 libraries reveals SARS-CoV-2 variant shifts in receptor usage

  Nidhi Shukla, et al., bioRxiv - Genetics 2024

  Quote: ... or the Alpha (Addgene # 170451), Beta (Addgene # 170449) ...
• Pseudotyped virus infection of multiplexed ACE2 libraries reveals SARS-CoV-2 variant shifts in receptor usage

  Nidhi Shukla, et al., bioRxiv - Genetics 2024

  Quote: ... derived from the LLP-Int-BFP-IRES-iCasp9-Blast construct (Addgene plasmid #171588), was described previously[3] ...
• DNA-PKcs Suppresses Illegitimate Chromosome Rearrangements

  Jinglong Wang, et al., bioRxiv - Genetics 2024

  Quote: ... The Lenti-iCas9-Neo vector containing the Flag-iCas9-P2A-GFP cassette for Cas9 expression in K562 cells was obtained as a gift from Qin Yan (Addgene plasmid #85400,35). For Cas9 expression in HEK293T cells ...
• Polyamine-mediated sensitization of Klebsiella pneumoniae to macrolides through a dual mode of action

  Joshua M. E. Adams, et al., bioRxiv - Microbiology 2024

  Quote: ... using an engineered plasmid that encodes a deGFP protein and a malachite green RNA aptamer (PT7-deGFP-MGapt was a gift from Richard Murray, via Addgene plasmid # 67741 ...
• PPARγ mediated enhanced lipid biogenesis fuels Mycobacterium tuberculosis growth in hepatocytes

  Binayak Sarkar, et al., bioRxiv - Microbiology 2024

  Quote: ... pMSP12: mCherry plasmid (Addgene No. 30169) was electroporated in H37RV to generate Mtb-H37Rv-mCherry.To prepare the single-cell suspension needed for infection tests ...
• PPARγ mediated enhanced lipid biogenesis fuels Mycobacterium tuberculosis growth in hepatocytes

  Binayak Sarkar, et al., bioRxiv - Microbiology 2024

  Quote: ... pMN437-GFPm2 vector (Addgene, 32362) was used to electroporate the virulent H37Rv strain in order to create GFP-H37Rv ...
• The impact of micro-habitat fragmentation on microbial populations growth dynamics

  Dina Mant, Tomer Orevi, Nadav Kashtan, bioRxiv - Microbiology 2024

  Quote: ... coli MG-1655 cells harboring the pEB1-mGFPmut2 plasmid where used throughout the study (pEB1-mGFPmut2 was a gift from Philippe Cluzel, Addgene plasmid #103980 ...
• All three MutL complexes are required for repeat expansion in a human stem cell model of CAG-repeat expansion mediated glutaminase deficiency

  Bruce Hayward, et al., bioRxiv - Genetics 2024

  Quote: ... was a gift from Shinya Yamanaka (Addgene plasmid # 41856 ...
• All three MutL complexes are required for repeat expansion in a human stem cell model of CAG-repeat expansion mediated glutaminase deficiency

  Bruce Hayward, et al., bioRxiv - Genetics 2024

  Quote: ... Plasmid pCK002_U6-Sa-sgRNA(mod)_EFS-SaCas9-2A-Puro_WPRE was a gift from Aviv Regev (Addgene plasmid # 85452 ...
• Mutations in the non-catalytic polyproline motif destabilize TREX1 and amplify cGAS-STING signaling

  Abraham Shim, et al., bioRxiv - Genetics 2024

  Quote: ... Constructs were transfected into 293FT cells together with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
• All three MutL complexes are required for repeat expansion in a human stem cell model of CAG-repeat expansion mediated glutaminase deficiency

  Bruce Hayward, et al., bioRxiv - Genetics 2024

  Quote: ... the SaCas9 promoter and the SaCas9 ORF from Addgene plasmid 85452 using a Gibson Assembly strategy ...
• Detailed mechanisms for unintended large DNA deletions with CRISPR, base editors, and prime editors

  Gue-ho Hwang, et al., bioRxiv - Genetics 2024

  Quote: Our custom CRISPRi library was constructed using pAX198 (Addgene #173042) that includes pU6-sgRNA-EF1a-Puro-T2A-BFP ...
• Detailed mechanisms for unintended large DNA deletions with CRISPR, base editors, and prime editors

  Gue-ho Hwang, et al., bioRxiv - Genetics 2024

  Quote: ... Transfection was carried out with psPAX2 (Addgene #12260), pMD2.G Addgene #12259) ...
• Detailed mechanisms for unintended large DNA deletions with CRISPR, base editors, and prime editors

  Gue-ho Hwang, et al., bioRxiv - Genetics 2024

  Quote: HeLa CRISPRi cells were generated by lentiviral integration (∼3 to 5 MOI) using the dCas9-KRAB-blast plasmid (Addgene #89567), followed by single cell isolation ...
• All three MutL complexes are required for repeat expansion in a human stem cell model of CAG-repeat expansion mediated glutaminase deficiency

  Bruce Hayward, et al., bioRxiv - Genetics 2024

  Quote: ... Plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
• Bridge RNAs direct modular and programmable recombination of target and donor DNA

  Matthew G. Durrant, et al., bioRxiv - Genetics 2024

  Quote: The IS621 recombinase gene was human codon optimized and cloned into a modified pFastBac expression vector (Addgene, Item ID: 30115), which includes an N-terminal His6-tag ...
• Multifocal Ectopic Purkinje Premature Contractions due to neutralization of an SCN5A negative charge: structural insights into the gating pore hypothesis

  Andrew M. Glazer, et al., bioRxiv - Genetics 2024

  Quote: A CRIPSR guide for the SCN5A E171Q mutation was designed using the CRISPOR online tool.20 We cloned the guide sequence (AATCTTGACCAGAGACTCAA-AGG) into SpCas9-2A-GFP (pX458, Addgene #48138)21 by annealing complementary primers 5’CACCGAATCTTGACCAGAGACTCAA and 5’AAACTTGAGTCTCTGGTCAAGATTC ...
• Separation of telomere protection from length regulation by two different point mutations at amino acid 492 of RTEL1

  Riham Smoom, et al., bioRxiv - Genetics 2024

  Quote: ... the T7 promoter sequence was added to the sgRNA template by PCR amplification using pX335 (Addgene #42335) with Phusion high-fidelity DNA Polymerase Kit (NEB) ...
• Exploring adaptation routes to low temperatures in the Saccharomyces genus

  Javier Pinto, et al., bioRxiv - Genetics 2024

  Quote: ... while pRS418 (Addgene plasmid #11256) was used to amplify the clonNAT cassette and also was the vector of choice for Gibson assembly cloning methodology for the promoter/allele swap experiments.
• TDG orchestrates ATF4-dependent gene transcription during retinoic acid-induced cell fate acquisition

  Marion Turpin, et al., bioRxiv - Genomics 2024

  Quote: ... flanking the region of interest were designed using CRISPOR (http://crispor.tefor.net/) to be further introduced either into pX458 or pX459 vectors from Addgene (each vector contains one gRNA). pX458 and pX459 vectors were previously digested 2hours at 37°C by BbsI (NEB ...
• Cryptic genetic variation shapes the fate of gene duplicates in a protein interaction network

  Soham Dibyachintan, et al., bioRxiv - Evolutionary Biology 2024

  Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas929 ...
• Cryptic genetic variation shapes the fate of gene duplicates in a protein interaction network

  Soham Dibyachintan, et al., bioRxiv - Evolutionary Biology 2024

  Quote: ... we co-transformed them with a pCAS plasmid (Addgene) targeting the HPH marker and the eGFP sequence with homology arms for each locus50 ...
• Cryptic genetic variation shapes the fate of gene duplicates in a protein interaction network

  Soham Dibyachintan, et al., bioRxiv - Evolutionary Biology 2024

  Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas9 with the PCR amplified MYO3 and MYO5 SH3 single position mutated libraries from the pUC19 preparations acting as the donor DNA29 ...