Labshake search
Citations for Addgene :
1951 - 2000 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... AAV-Syn-CoChR-GFP (Addgene #59090)(66) ...
-
bioRxiv - Cancer Biology 2024Quote: The ABCB-CoChR gene fragments were amplified from CMV-ABCB-CoChR-eYFP and cloned into pcDNA3.0-Magneto2.0-p2A-mCherry (Addgene #74308) backbone vector using the HiFi Assembly Kit ...
-
bioRxiv - Microbiology 2024Quote: ... An amplicon of the pyrimethamine selectable cassette (DHFR-TS) was amplified from the pLoxp-DHFR-TS-mCherry plasmid (Addgene plasmid #70147) containing similar homology arms to the targeted protospacer sequences ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lenti-U6BC-sgDbl/Cre vectors were transfected as a pool into 293T cells with pCMV-VSV-G (Addgene #8454) envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Microbiology 2024Quote: ... Xin Lin (Addgene plasmid # 44157;http://n2t.net/addgene:44157 ...
-
bioRxiv - Cancer Biology 2024Quote: ... It was synthesized and cloned into CRISPRseq-BFP-backbone (Addgene). The quality of the pooled-CRISPR-sgRNA library was verified by Illumina sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pMD2.G (Addgene) packaging vectors into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: Lentivirus were produced by co-transfecting the transfer vector of interest with psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... Lentiviruses carrying the target genes were generated by co-transfecting lentiviral transfer plasmid (pLVX-EF1a-Puro) with packaging plasmids pMD2G (Addgene, 12259) and psPAX2 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... and psPAX2 (Addgene, 12260) into HEK293T cells through GeneTwin transfection reagent (Biomed ...
-
bioRxiv - Molecular Biology 2024Quote: ... To generate MPST-/- HeLa cells single guide RNAs (sgRNAs) against MPST (fwd: CACCGGCGTCGTAGATCACGACGT, rev: AAACACGTCGTGATCTACGACGCC) were subcloned into the plentiCRISPR V1 (Addgene 52963). Subcloned plasmids were co-transfected into HEK293T cells with lentiviral packaging vectors ...
-
bioRxiv - Molecular Biology 2024Quote: The human MPST expression plasmid with the N-terminal His tag with TEV cleavage site (MPSTA) was a gift from Nicola Burgess-Brown (Addgene plasmid #42482). This construct was co-expressed with chaperones groEL ...
-
bioRxiv - Molecular Biology 2024Quote: ... HAMECs were transfected with mCherry-CD36-C-10 (Addgene: Plasmid #55011), 8µg of plasmid was used per 1 million cells using nucleofection.
-
bioRxiv - Microbiology 2024Quote: ... using plasmid L5 attB::Pleft*mScarlet/mWasabi (Addgene plasmids 169410 and 169409 ...
-
bioRxiv - Microbiology 2024Quote: ... was a gift from Marcel Bruchez (Addgene plasmid #101156). The codon-optimized T7RNAP coding sequence was amplified from T7 opt in pCAGGS (14 ...
-
bioRxiv - Microbiology 2024Quote: ... The codon-optimized T7RNAP coding sequence was amplified from T7 opt in pCAGGS (14) (Addgene #65974; a kind gift from Benhur Lee) by PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... respectively (Addgene, https://www.addgene.org/Christopher_Grefen/) ...
-
bioRxiv - Genomics 2024Quote: ... pLL3.7 (Addgene, Watertown, MA), and contains the nc886 gene (a 102 nucleotide (nt)-long DNA fragment ...
-
bioRxiv - Genomics 2024Quote: ... SERBP1 ORF was inserted into the pcDNA3.1-mGreenLantern plasmid (Addgene Plasmid #161912) to make mGreen-SERBP1 ...
-
bioRxiv - Genomics 2024Quote: ... Flag-PARP1 was obtained from Addgene (#111575).
-
bioRxiv - Neuroscience 2024Quote: ... HEK293T cells were co-transfected with the second-generation packaging plasmid psPAX2 (Addgene #12260), envelope plasmid VSV-G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2024Quote: Voltron1 and Voltron2 plasmids were obtained from Addgene (#119033 and #172909, respectively). For lentiviral transduction ...
-
bioRxiv - Neuroscience 2024Quote: ... we used a previously-published whole-cell-expressing construct10 (Addgene #203228). For in vivo experiments ...
-
bioRxiv - Microbiology 2024Quote: ... and 125 ng of FLAG-tagged Med26 (a gift from Joan Conaway and Ronald Conaway [Addgene plasmid #15367; http://n2t.net/addgene:15367; RRID:Addgene_15367)(59)] expression vectors ...
-
bioRxiv - Microbiology 2024Quote: ... wells were transfected with 500 ng of RSV Gag-GFP (11) and 125 ng of FLAG-tagged Med26 (a gift from Joan Conaway and Ronald Conaway [Addgene plasmid #15367 ...
-
bioRxiv - Molecular Biology 2024Quote: The human MPST expression plasmid with the N-terminal His tag with TEV cleavage site (MPSTA) was a gift from Nicola Burgess-Brown (Addgene plasmid #42482). The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340) ...
-
bioRxiv - Microbiology 2024Quote: ... the LentiCRISPRv2 plasmid (Addgene, Cat# 52961) was used as an empty vector to establish the control cell line ...
-
bioRxiv - Microbiology 2024Quote: ... pKIKOarsBKm was a gift from Lars Nielsen & Claudia Vickers (Addgene plasmid # 46766 ...
-
bioRxiv - Microbiology 2024Quote: ... pCasSA was a gift from Quanjiang Ji (Addgene plasmid # 98211). The primers used in the study are listed in Table S1.
-
bioRxiv - Microbiology 2024Quote: ... were cloned into CMV Blast DEST (706–1) (a gift from Eric Campeau & Paul Kaufman, Addgene plasmid #17451) expression vector resulting in plasmid AX581 ...
-
bioRxiv - Microbiology 2024Quote: The human CRISPR (clustered regularly interspaced short palindromic repeats) “Brunello” lentiviral pooled library was purchased from Addgene. The library version in the lentiCRISPRv2 backbone was chosen ...
-
bioRxiv - Microbiology 2024Quote: ... 3.6μg psPAX2 (Gag-Pol expression construct, a gift from Didier Trono (Addgene plasmid #12260), and 5μg of lentiviral expression constructs (pLenti CMV Blast DEST (706–1) ...
-
bioRxiv - Microbiology 2024Quote: ... 10cm cell culture grade petri dishes of approximately 80% confluent 293T cells were transfected with 1.4μg pMD2.G (VSV-G envelope expressing plasmid, a gift from Didier Trono (Addgene plasmid #12259), 3.6μg psPAX2 (Gag-Pol expression construct ...
-
bioRxiv - Microbiology 2024Quote: ... psPAX2 packaging plasmids (Addgene #12260), and pMD2.G plasmid expressing VSV-G (Addgene #12259 ...
-
bioRxiv - Microbiology 2024Quote: ... pKIKOarsBKm was a gift from Lars Nielsen & Claudia Vickers (Addgene plasmid # 46766; http://n2t.net/addgene:46766; RRID:Addgene_46766). E ...
-
bioRxiv - Microbiology 2024Quote: ... pAR18 was constructed in three steps: 1) pTargetF (obtained from Addgene) was linearized with the primer pair AR430/431 while the cas9 sgRNA sequence was replaced by the sacB gene including its native promoter (amplified with AR432/433 from pEP17-KM [44]) ...
-
bioRxiv - Microbiology 2024Quote: ... AR426/427 was used for backbone amplification from p46Cpf1-OP2 (obtained from Addgene) and AR428/429 was used to amplify the p15A ori from a pACYC-derived vector ...
-
bioRxiv - Microbiology 2024Quote: ... 2.4 µg and 9,6µg of the packaging plasmids pCMV-VSV-G (Addgene #8454) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Microbiology 2024Quote: ... and psPAX2 (Addgene #12260) respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were transfected with mCherry-CD36-C-10 (Addgene: Plasmid #55011), 5µg per 10cm dish or 0.5µg per well of a 6-well dish ...
-
bioRxiv - Microbiology 2024Quote: ... (Addgene plasmid # 111820; http://n2t.net/addgene:111820; RRID:Addgene_111820)
-
bioRxiv - Microbiology 2024Quote: ... (Addgene plasmid # 111820 ...
-
bioRxiv - Microbiology 2024Quote: ... The TFEB wild-type (WT-TFEB [plasmid #38119]) and mutant (Δ30-TFEB [plasmid #44445]) constructs were obtained from Addgene (deposited by Shawn Ferguson) and transfected into H1HeLa using the Lipofectamine 2000 transfection reagent ...
-
bioRxiv - Microbiology 2024Quote: ... pLEW100V5-BSD was a gift from George Cross (Addgene plasmid # 27658 ...
-
bioRxiv - Microbiology 2024Quote: ... pRPaCa9 was a gift from David Horn (Addgene plasmid # 111819 ...
-
bioRxiv - Microbiology 2024Quote: ... and 5.5 μg of psPAX2 (Addgene, Cat# 12260), into HEK293T cells (6×106 cells ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR fragment was subcloned in the BamHI and NotI site of pET-28a+GFP-CAMSAP1 CKK (Addgene #59033), which contains 6 histidine (His ...
-
bioRxiv - Immunology 2024Quote: ... and the packaging vector psPAX2 was a kind gift from Didier Trono (Addgene plasmid # 12260).
-
bioRxiv - Immunology 2024Quote: ... The plasmid expresses EGFP under the constitutive EF1α promoter and was a kind gift from Didier Trono (Addgene plasmid # 12254). pWPI-mBatf-GFP was generated by ligating a murine BATF encoding sequence using SwaI and PacI restriction sites upstream of an IRES sequence into the pWPI expression plasmid ...
-
bioRxiv - Microbiology 2024Quote: A doxycycline-inducible CRISPR/Cas9 expression vector (pSBtet-puro-Cas9-U6) was generated by cloning the Cas9-U6 portion of pX459 (Addgene #62988; [49] into pSBtet-pur (Addgene #60507; [50]). Cas9 was first cloned into pSBtet-pur using the following primers ...