Labshake search
Citations for Addgene :
1551 - 1600 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... sgRNAs were cloned into BsmB1-linearized lentiCRISPR-v1-GFP (Addgene) by T4 DNA ligase (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... The OVA entry fragment was created using a PCR amplicon from OVA plasmid (Addgene plasmid 64599) with primers containing attB sites (Table 1 ...
-
bioRxiv - Immunology 2024Quote: ... Plasmids with correct insert were cloned into a lentivirus backbone destination vector (Addgene, plasmid 17451) with LR Clonase II Enzyme Mix (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... followed by transfection with OVA lentivirus transfer vector and lentivirus packaging vectors psPAX2 (Addgene, plasmid 12260) and pMD2.G (Addgene ...
-
bioRxiv - Immunology 2024Quote: ... and pMD2.G (Addgene, plasmid 12259) using Lipofectamine3000 transfection reagent (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: The TRE3G-dCas9-VPR fragment was obtained by digestion of the PB-TRE-dCas9-VPR vector (Addgene #63800) with PmeI and PspXI ...
-
bioRxiv - Genomics 2024Quote: ... as well as the Rosa26- and Tigre-specific sgRNA-encoding plasmids (pX335-EN479, pX335-EN481 and pX330-EN1201 (Addgene #92144)) were all provided by E ...
-
bioRxiv - Genomics 2024Quote: ... The fragment was subsequently cloned by DNA ligation in the donor vector pEN366 (Addgene #156432), after removal of the TRE3G-CTCF-mRuby2 fragment by digestion using the same restriction enzymes ...
-
bioRxiv - Genomics 2024Quote: ... pCAG-CreERT2 (Addgene #14797) and pCAG-ERT2CreERT2 (Addgene #13777 ...
-
bioRxiv - Genomics 2024Quote: Recombinase expression plasmids used in this study are pCAG-iCre (Addgene #89573), pCAG-CreERT2 (Addgene #14797 ...
-
bioRxiv - Genomics 2024Quote: ... and pCAG-ERT2CreERT2 (Addgene #13777) and pCAG-Bxb1 (pSP0722 ...
-
bioRxiv - Genomics 2024Quote: ... and pCAG-Bxb1 (pSP0722, modified from Addgene #51271). Between 200,000 and 350,000 cells were reverse transfected with the specific Cre plasmid using Lipofectamine 3000 (Thermo L3000001 ...
-
bioRxiv - Immunology 2024Quote: ... grown in wells of 6-well plates with 1000 ng psPAX2 (Addgene plasmid #12260) packaging plasmid ...
-
bioRxiv - Genomics 2024Quote: ... according to the manufacturers instructions with 200 ng pMD2.G (Addgene #12259), 600 ng psPAX2 (Addgene #12260 ...
-
bioRxiv - Genomics 2024Quote: ... 15 μg psPAX2 (Addgene #12260) and 20 μg of the transfer vector ...
-
bioRxiv - Genomics 2024Quote: ... 600 ng psPAX2 (Addgene #12260) and 500 ng of the transfer vector ...
-
bioRxiv - Genomics 2024Quote: ... The Tet1cdCas9 plasmid was generated by amplifying Tet1c from Addgene #108245 ...
-
bioRxiv - Genomics 2024Quote: ... 4.5 x 106 cells were transfected using the calcium phosphate precipitation method (Salmon and Trono, 2007) with 6 μg pMD2.G (Addgene #12259), 15 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Genomics 2024Quote: ... Lentivirus was produced in HEK293T cells co-expressing the shRNA plasmid together with psPAX2 packaging plasmid and pVSV-G envelope plasmid (Addgene). Virus was concentrated using Lenti-X Concentrator (Takara ...
-
bioRxiv - Genetics 2024Quote: ... The Lenti-iCas9-Neo vector containing the Flag-iCas9-P2A-GFP cassette for Cas9 expression in K562 cells was obtained as a gift from Qin Yan (Addgene plasmid #85400,35). For Cas9 expression in HEK293T cells ...
-
bioRxiv - Genomics 2024Quote: ... and EBFP2-NLS (Addgene ID 216219) selection markers are available through Addgene ...
-
bioRxiv - Genetics 2024Quote: Traffic light reporter (TLR) constructs were ordered from Addgene (Plasmid #s 64323 ...
-
bioRxiv - Genetics 2024Quote: To generate B16F10 cells with a H2B-mCherry reporter the H2B mCherry reporter plasmid (Addgene Plasmid # 20972) was co-transfected with packaging plasmids PAX2 and pMD2.G into HEK293T ...
-
bioRxiv - Genetics 2024Quote: ... FUZ-mCherry was generated by sub-cloning with XhoI/BamHI into mCherry2-N1 backbone vector (Addgene #54517). FUZ deletion mutants (dN and dC ...
-
bioRxiv - Genomics 2024Quote: Empty Tet-pLKO-puro plasmid70 was purchased from Addgene (#21915), and shRNA oligos for insertion (Table 1 ...
-
bioRxiv - Genomics 2024Quote: ... DNMT1 and respective mutants (Table 2) were cloned into the pMXs-IRES-blasticidin retroviral vector (a gift from David Sabatini, Addgene #72876) by EcoRI and XhoI restriction sites without an affinity tag ...
-
bioRxiv - Genomics 2024Quote: ... Donor plasmids used for knock-ins at the Rosa26 (pEN111) and Tigre locus (pEN366, Addgene #156432), as well as the Rosa26- and Tigre-specific sgRNA-encoding plasmids (pX335-EN479 ...
-
bioRxiv - Developmental Biology 2024Quote: ... TRCN000000616) were co-transfected with packaging psPAX2 (Addgene #12260) and envelope pMD2.G (Addgene #12259 ...
-
bioRxiv - Developmental Biology 2024Quote: ... were purchased from Addgene (Addgene, cat. #73797, 61425, and 61426). The single guide RNAs (sgRNAs ...
-
bioRxiv - Developmental Biology 2024Quote: ... and MS2-P65-HSF1) were purchased from Addgene (Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: Kaede mRNA was produced using the HiScribe™ T7 ARCA mRNA Kit (with tailing) by New England Biolabs (Catalog #E2060S) from a PCR-amplified template of the Kaede-NLS plasmid sourced from Addgene (Plasmid #57319). After mRNA synthesis ...
-
bioRxiv - Developmental Biology 2024Quote: ... The putative enhancer regions were cloned into the pE1b-GFP-Tol2-Gateway vector (Addgene, plasmid # 37846) [38] ...
-
bioRxiv - Developmental Biology 2024Quote: ... Each sgRNA was cloned in the plasmid pX459 (Addgene, #48139) and 8µg of each vector was used during mESCs transfection following the standard procedure for mESCs culture and genomic editing (Andrey and Spielmann ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... TetO-NGN2-eGFP-Puro plasmid (Addgene, #79823) using Polyethyleneimine (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... RSV (Addgene, #12253), pMDL (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... E2Crimson Mtb was generated by transformation with pTEC19 (Addgene 30178 ...
-
bioRxiv - Cell Biology 2024Quote: ... B16-F1 cells were transiently transfected with LifeAct-TagRed and PA-GFP-Actin (Addgene #57121) as described above ...
-
bioRxiv - Cell Biology 2024Quote: B16-F1 cells were transiently transfected with pEGFP-Paxillin (Addgene plasmid #15233) as described above and plated onto 35 mm glass-bottom Ibidi dishes coated with laminin ...
-
bioRxiv - Cell Biology 2024Quote: pGFP-EB1 (Addgene plasmid #17234) was transiently transfected into the B16-F1 control and Cyri-b KO cells and imaged live on a Zeiss 880 microscope with Airyscan with a Plan-Apochromat 63x/1.4 oil DIC objective lens with the 488nm laser at 1 image per second for 120 seconds ...
-
bioRxiv - Cell Biology 2024Quote: B16-F1 cells were transiently transfected with CYRI-B-p17-GFP and mCherry-β1 integrin (Addgene plasmid #55064) and plated on laminin coated glass bottom dishes ...
-
bioRxiv - Cell Biology 2024Quote: ... subsequently Dm-KHC(1-421)-SNAP-6xHis (gift from Kapitein lab, Addgene plasmid #196976) labelled with Alexa647-SNAP dye (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... envelope plasmid (Addgene plasmids were a gift of D ...
-
bioRxiv - Cell Biology 2024Quote: ... and pMD2.VSVG (Addgene, #12259) envelope plasmid (Addgene plasmids were a gift of D ...
-
bioRxiv - Cell Biology 2024Quote: ... the lentiviral psPAX packaging (Addgene, #12260) and pMD2.VSVG (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... Complementary gRNAs were annealed and subcloned into the pSpCas9(BB)-2A-GFP (pX-458) vector (#48138; Addgene) between BbsI endonuclease restriction sites ...
-
bioRxiv - Cell Biology 2024Quote: ... which was a gift from Kevin Janes (Addgene plasmid #136536; http://n2t.net/addgene:136536; RRID:Addgene_136536). Constructs were validated with Sanger sequencing before use ...
-
bioRxiv - Cell Biology 2024Quote: ... which was a gift from Kevin Janes (Addgene plasmid #136536 ...
-
bioRxiv - Cell Biology 2024Quote: ... The pmGFP-P2A-K0-P2A-RFP (Addgene #105686) and pmGFP-P2A-K20-P2A-RFP (Addgene #105688 ...
-
bioRxiv - Cell Biology 2024Quote: ... a LAMP1-mRFP plasmid (Addgene, 34611) was linearized using NdeI ...