Labshake search
Citations for Addgene :
1851 - 1900 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... the pCX-EGFP beta5 integrin receptor 20 was a gift from Raymond Birge (Addgene plasmid # 14996; http://n2t.net/addgene:14996; RRID:Addgene_14996). For ITGAV depletion ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pCMV-VSV-G 24 (a gift from Bob Weinberg, Addgene plasmid # 8454; http://n2t.net/addgene:8454; RRID: Addgene_8454), into the HEK293T cells by using the TransIT-Lenti transfection reagent (Mirus Bio) ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 (a gift from Didier Trono, Addgene plasmid # 12260 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pCMV-VSV-G 24 (a gift from Bob Weinberg, Addgene plasmid # 8454 ...
-
bioRxiv - Biochemistry 2024Quote: ... and pGEX-6P-1-INTS3-FL were gifts from Yuliang Wu (Addgene plasmids #128307 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pVSV-G was a gift from Bob Weinberg (Addgene plasmid #8454). The single guide RNA (sgRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... LentiV-cas9_puro and Lenti_sgRNA_EFS_GFP plasmids (Addgene #108100 and 65656, respectively) were gifts from Christopher Vakoc ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 was a gift from Didier Trono (Addgene plasmid #12260). pVSV-G was a gift from Bob Weinberg (Addgene plasmid #8454) ...
-
bioRxiv - Cell Biology 2024Quote: ... the human WT LZTR1 coding sequence was synthesized (Genewiz/Azenta Life Sciences) and subcloned in pcDNA3-HA-humanNEMO (gift from Kunliang Guan, Addgene plasmid #13512) by exchanging the NEMO coding sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... and mCherry-MyosinIIB-N-18 (Addgene #55107) was achieved using a Nucleofector II electroporator and the Cell Line Nucleofector Kit V (Lonza Biosciences) ...
-
bioRxiv - Cell Biology 2024Quote: ... EMTB-3XGFP was a gift from William Bement [29] (Addgene plasmid # 26741 ...
-
bioRxiv - Cell Biology 2024Quote: ... EMTB-3XGFP was a gift from William Bement [29] (Addgene plasmid # 26741 ; http://n2t.net/addgene:26741; RRID:Addgene 26741) For Lifeact-mEmerald (pLVSIN-EF1a-Lifeact-mEmerald-IRES-pur) ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ; http://n2t.net/addgene:54148 ; RRID:Addgene 54148) For protein depletion ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 (gift from Didier Trono; Addgene plasmid # 12260), and pMD2.G (gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2024Quote: ... was amplified and purified as directed by Addgene. Lentiviral particles were generated by transfecting HEK293T cells with the GeCKOv2 CRISPR Knockout Pooled Plasmid Library ...
-
bioRxiv - Cancer Biology 2024Quote: ... The Toronto KnockOut Library v3 (TKOv3) (90294) was from Addgene. The DNA Damage Response MKOv4 Library (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: (Addgene #10878) was used for shRNA constitutive knockdown in cancer cells ...
-
bioRxiv - Cancer Biology 2024Quote: (Addgene #158560) was used for doxycycline-inducible SOX9 overexpression ...
-
bioRxiv - Cancer Biology 2024Quote: Lentiviral transduction of shRNA targeting Hmox1 was completed following viral preparation using plasmids supplied by the La Jolla Institute for Immunology (Seq1: TRCN0000045250: ACAGTTGCTGTAGGGCTTTAT, Seq2: TRCN0000045251: CAACAAGGAGAGCCCAGTCTT) and gifted from Didier Trono (RRID:Addgene_12259, RRID:Addgene_12260). Aco1 was targeted using sequences from the Mission Database (Seq1 ...
-
bioRxiv - Cancer Biology 2024Quote: Lentiviral transduction of shRNA targeting Hmox1 was completed following viral preparation using plasmids supplied by the La Jolla Institute for Immunology (Seq1: TRCN0000045250: ACAGTTGCTGTAGGGCTTTAT, Seq2: TRCN0000045251: CAACAAGGAGAGCCCAGTCTT) and gifted from Didier Trono (RRID:Addgene_12259, RRID:Addgene_12260). Aco1 was targeted using sequences from the Mission Database (Seq1 ...
-
bioRxiv - Cancer Biology 2024Quote: pLenti.CAG.H2B.Dendra2.W was a gift from Rusty Lansford (Addgene plasmid #51005; RRID:Addgene_51005). N-cad WT or W161A mutated DNA were amplified by PCR from pCAG-Ncad WT or W161A-HA (Kon et al. ...
-
bioRxiv - Cancer Biology 2024Quote: pLenti.CAG.H2B.Dendra2.W was a gift from Rusty Lansford (Addgene plasmid #51005; RRID:Addgene_51005). N-cad WT or W161A mutated DNA were amplified by PCR from pCAG-Ncad WT or W161A-HA (Kon et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... After 32 hours cells were transfected with an equimolar mix of CK2α/β plasmid (Addgene; #27093) and the relevant MCAM tail variant ...
-
bioRxiv - Cancer Biology 2024Quote: ... DR8.2 (1 µg) packaging construct (Addgene #8455) and the PMD2.G (5 μg ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the PMD2.G (5 μg) envelope construct (Addgene # 12259) were added to the solution ...
-
bioRxiv - Immunology 2024Quote: ... optogenetic constructs were cloned into pLV-EF1a-IRES-Hygro (Addgene #85134) which encodes a Hygromycin B resistance cassette ...
-
bioRxiv - Immunology 2024Quote: ... and mScarlet-I into pCW57.1 (Addgene #41393). All lentivirus vectors are listed in Table S3.
-
bioRxiv - Microbiology 2024Quote: ... a gift from David Root (Addgene plasmid # 10878 ; http://n2t.net/addgene:10878 ; RRID:Addgene_10878)77 ...
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... The sgRNA targeting sequences were separately cloned into the px330mCherry (Addgene #98750). A list of all oligonucleotides is provided in Supplementary Table S3 ...
-
bioRxiv - Cell Biology 2024Quote: ... the FUS was amplified by PCR from the plasmid pHR-FUSN-mCh-Cry2WT (Addgene, #101223) with primer set #3 (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... pHPRT-DRGFP and pCBASceI were a gift from Maria Jasin (Addgene plasmids # 26476 and #26477).
-
bioRxiv - Cell Biology 2024Quote: ... The mGFP (Emerald) was amplified from Tom20-Emerald (#54282, Addgene, USA) and the CIBN was amplified from CIBN-CAAX (#79574 ...
-
bioRxiv - Cell Biology 2024Quote: ... The PASSst sensor was created by fusion of two copies of PABD with the GCN4 that was amplified from pcDNA4TO-24xGCN4_v4-kif18b (#74934, Addgene, USA). The GCN4 probe was pHR-scFv-GCN4-sfGFP-GB1-dWPRE (#60907 ...
-
bioRxiv - Immunology 2024Quote: ... and pMD2.G (Addgene #12259). Lentiviruses were generated by transfecting low-passage HEK293T cells with these plasmids ...
-
bioRxiv - Immunology 2024Quote: ... and pCI AscI MR1 R9H res (Addgene ID 214753) contain silent mutations to make the sequence resistant to CRISPR/Cas9 editing in the MR1-/- background ...
-
bioRxiv - Immunology 2024Quote: ... The amplified insert was subcloned into pLV-EF1α-IRES-Blast vector (Addgene, plasmid #85133), which is then used to for generating P5-CCL2OE ...
-
bioRxiv - Immunology 2024Quote: ... MP5-Hif1α KO lines were made via transducing MP5 cells with sgHif1a or sgNT cloned into lentiCRISPRv2-GFP (Addgene, plasmid #82416) and sorting for GFP.
-
bioRxiv - Immunology 2024Quote: ... and then transduced with sgMll3 or sgNT cloned into pLKO5.sgRNA.EFS.tRFP (Addgene, plasmid #57823). Cells were grown for 3 days and selected with puromycin for 3 days ...
-
bioRxiv - Cell Biology 2024Quote: ... pLentiPGK Puro DEST ERKKTRClover was a gift from Markus Covert (RRID:Addgene_90227), pMD2.G was a gift from Didier Trono (RRID:Addgene_12259) ...
-
bioRxiv - Cell Biology 2024Quote: ... and psPAX2 was a gift from Didier Trono (RRID:Addgene_12260). Virus was harvested from day 2 to day 5 post-transfection by medium collection and centrifugation at 500×g at 4°C for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... The CRISPR-assisted insertion tagging system (CRISPaint) 8 plasmid (pCRISPR-HOT-Clover- BlastR) was obtained from Addgene (Plasmid #138569 ...
-
bioRxiv - Cell Biology 2024Quote: ... Transient expression of CMV-GFP-NMHC-IIA (Addgene #11347) and mCherry-MyosinIIB-N-18 (Addgene #55107 ...
-
bioRxiv - Cell Biology 2024Quote: ... the BamHI-NotI fragment from GAKdY (55) was ligated into the BamHI-NotI backbone of tdEOS-paxillin-22 (plasmid #57653; Addgene), replacing the tdEOS sequence to produce plasmid paxillin-GAKdy ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP-Tensin3 (catalog #105299) was purchased from Addgene.
-
bioRxiv - Cell Biology 2024Quote: The pLKO.1 – TRC cloning vector was a gift from David Root (Addgene plasmid # 10878; http://n2t.net/addgene:10878 ; RRID:Addgene_10878). The shRNA sequences were cloned into the AgeI and EcoRI sites of the plasmid using standard cloning techniques ...
-
bioRxiv - Biochemistry 2024Quote: ... The genes were cloned into pHis17 vector (obtained from Löwe lab, MRC LMB, Cambridge; refer Addgene plasmid #78201 for vector backbone) using restriction-free cloning (van den Ent and Löwe ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Neuroscience 2024Quote: ... The SINV genomic and package RNAs (Addgene #72309) were transfected into BHK cells using Lipofectamine 2000 ...