Labshake search
Citations for Addgene :
1851 - 1900 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... YFP-RPB1-WT (52xCTD) was obtained from Addgene, YFP-RPB1-26xCTD and T4E/S7E mutants were generated by PCR-based cloning performed by a kit from ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... were generated by simultaneously targeting RNF43 (gRNA: ATTGCACAGGTACAGCGGGT) and ZNRF3 (gRNA: GCCAAGCGAGCAGTACAGCG) with gRNAs cloned in a pSpCas9(BB)-2A-Puro vector (Addgene # 48139). Monoclonal cell lines that were homozygous knockout for both genes were confirmed by genotyping and functional analysis in a β-catenin-mediated reporter assay (Fig ...
-
bioRxiv - Cell Biology 2024Quote: The GCaMP5G plasmid was procured from Addgene (Cat# 31788). Lck was fused to GCaMP5G as described in Shigetomi et al ...
-
bioRxiv - Cell Biology 2024Quote: ... the HA-KDM4A (Addgene, Plasmid # 24180) construct was transfected using Lipofectamine2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with pEGFP-C1-Centrin-1 plasmid (Addgene, Plasmid # 72641) using Lipofectamine2000 according to the manufacture’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with a mixture of pSpCas9(BB)-2A-GFP plasmids (gift from Feng Zhang; Addgene plasmid #48138) containing two different sgRNA sequences (TTGGATGACTCGGACTCGCT and CGCTTGGTGATTCCATGTAA ...
-
bioRxiv - Cell Biology 2024Quote: ... Mis18BP11-490 was cloned from a codon optimised sequence (GeneArt) into the pET His6 MBP TEV (14C, Addgene plasmid #48309 ...
-
bioRxiv - Cell Biology 2024Quote: ... Mis18α and Mis18β genes were cloned into expression vectors pET His6 TEV (9B) and pET His6 msfGFP TEV (9GFP, Addgene plasmids #48284 and #48287 ...
-
bioRxiv - Cell Biology 2024Quote: ... Mis18BP1 and HJURP were cloned into pcDNA3 mCherry and pcDNA3 GFP vectors (6B and 6D, Addgene plasmids #30125 and #30127 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentivirus was produced from pLenti-SV40-T-tsA58 (abm cat# LV629) as previously described (51) using the VSV envelope from pMD2.G (Addgene cat#12259, gift from Didier Trono) and the packaging plasmid pCMV delta R8.2 (Addgene cat # 12263 ...
-
bioRxiv - Cell Biology 2024Quote: ... and the packaging plasmid pCMV delta R8.2 (Addgene cat # 12263, gift from Didier Trono). Primary glomerular outgrowths were infected for 48 hours followed by selection with puromycin (2ug/ml) ...
-
bioRxiv - Immunology 2024Quote: ... HEK293T cells were transfected with the lentiviral vector pScalps-EGFP-Cre recombinase (7) (Addgene plasmid 207132) together with the packaging vectors psPAX2 and pMD2.G (Addgene plasmids 12260 and 12259 by Didier Trono ...
-
bioRxiv - Immunology 2024Quote: ... targeting mouse Pvrl2 or Pvr were cloned into pSpCas9(BB)-2A-GFP plasmid (PX458, ADDGENE). 6 μg of each vector was transfected into tumor cells plated on a 6-well plate using FuGENE6 transfection reagent (Promega ...
-
bioRxiv - Immunology 2024Quote: ... The murine CD3 WTdelta-F2A-gamma-T2A-epsilon-P2A-zeta pMIA II plasmid was a gift from Dario Vignali (Addgene plasmid # 52093) [40] ...
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Plasmid harboring mVenus was obtained from Addgene (catalogue no.: 103986) and mTurquiose2 was a gift from Ondrej Havranek (coding sequence corresponding to Addgene catalogue no. ...
-
bioRxiv - Developmental Biology 2024Quote: Kaede mRNA was produced using the HiScribe™ T7 ARCA mRNA Kit (with tailing) by New England Biolabs (Catalog #E2060S) from a PCR-amplified template of the Kaede-NLS plasmid sourced from Addgene (Plasmid #57319). After mRNA synthesis ...
-
bioRxiv - Developmental Biology 2024Quote: ... The putative enhancer regions were cloned into the pE1b-GFP-Tol2-Gateway vector (Addgene, plasmid # 37846) [38] ...
-
bioRxiv - Developmental Biology 2024Quote: ... Each sgRNA was cloned in the plasmid pX459 (Addgene, #48139) and 8µg of each vector was used during mESCs transfection following the standard procedure for mESCs culture and genomic editing (Andrey and Spielmann ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Genetics 2024Quote: ... we interrupted the mCHERRY ORF of pGH044 (Addgene Plasmid #85412, RRID: Addgene_85412). We scanned mCHERRY for “AGGT” stretch and placed the intron between the AG and GT ...
-
bioRxiv - Genetics 2024Quote: ... we interrupted the mCHERRY ORF of pGH044 (Addgene Plasmid #85412, RRID: Addgene_85412). We scanned mCHERRY for “AGGT” stretch and placed the intron between the AG and GT ...
-
bioRxiv - Developmental Biology 2024Quote: ... pyogenes Cas9 under the expression of CAGC promoter) was a gift from Marianne Bronner (Addgene plasmid # 99138; http://n2t.net/addgene:99138; RRID: Addgene_99138). Tol2-U6.3-sgRNA-GFP was made by VectorBuilder expressing within a Tol2 transposon a cytoplasmic GFP reporter under the control of GAGC promoter and sgRNA guide expressed under chick specific U6.3 promoter ...
-
bioRxiv - Developmental Biology 2024Quote: pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3 was purchased from Addgene (112007). Full-length cDNA of GCaMP6s was PCR-amplified:
-
bioRxiv - Developmental Biology 2024Quote: pCAGG-NLS-Cas9-NLS (expressing nuclear localised S. pyogenes Cas9 under the expression of CAGC promoter) was a gift from Marianne Bronner (Addgene plasmid # 99138 ...
-
bioRxiv - Genetics 2024Quote: ... We next used the Gateway™ LR Clonase™ II Enzyme mix to recombine each of the four PCR products into the pBID-UASC-G backbone (Addgene Plasmid #35202), which contains a φC31 integrase compatible attB sequence and UAS binding sites for the GAL4 expression system (Wang et al ...
-
bioRxiv - Developmental Biology 2024Quote: Plasmid pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene, plasmid #42335; Cong et al., 2013) was used to synthesize DNA templates containing the single guide (sg)RNA scaffold ...
-
bioRxiv - Developmental Biology 2024Quote: ... USA) or GENEWIZ from Azenta Life Sciences (South Plainfield, NJ, USA) and subsequently cloned upstream of a H2B-mCerulean (Addgene #198059). Promoter activity was scored by microinjecting 25ng/μl of circular plasmid and screening for fluorescence in embryos 24 hours post fertilization (hpf) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The Minos transposase (pBlueSKMimRNA) plasmid was a gift from Michalis Averof (Addgene plasmid #102535). The piggyBac transposase (pT7mRNA-PB transposase ...
-
bioRxiv - Developmental Biology 2024Quote: ... and envelope pMD2.G (Addgene #12259) plasmids into 293T packaging cells (ATCC) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The pDEST-CMV-N-Tandem-mCherry-EGFP plasmid was a gift from Robin Ketteler (Addgene plasmid #123216; http://n2t.net/addgene:123216; RRID:Addgene_123216) (Agrotis and Ketteler ...
-
bioRxiv - Developmental Biology 2024Quote: ... The pDEST-CMV-N-Tandem-mCherry-EGFP plasmid was a gift from Robin Ketteler (Addgene plasmid #123216 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The sgRNAs were sub-cloned into the pX459 plasmid from Addgene, with 8 μg of each vector utilized for the transfection of mESCs ...
-
bioRxiv - Developmental Biology 2024Quote: ... TRCN000000616) were co-transfected with packaging psPAX2 (Addgene #12260) and envelope pMD2.G (Addgene #12259 ...
-
bioRxiv - Developmental Biology 2024Quote: ... were purchased from Addgene (Addgene, cat. #73797, 61425, and 61426). The single guide RNAs (sgRNAs ...
-
bioRxiv - Developmental Biology 2024Quote: ... and MS2-P65-HSF1) were purchased from Addgene (Addgene ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Genetics 2024Quote: ... containing BrdU cassette obtained from Addgene (Addgene plasmid # 71789-71792), were integrated at four different auxotrophic loci (HIS3 ...
-
bioRxiv - Genetics 2024Quote: ... pML104 was a gift from John Wyrick (Addgene plasmid # 67638)(Laughery et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... pCAG-myr-mRFP (Addgene #32604), or pCAG-DeAct-SpvB (a fusion protein of DeAct-SpvB with EGFP ...
-
bioRxiv - Developmental Biology 2024Quote: ... or pCAG-DeAct-SpvB (a fusion protein of DeAct-SpvB with EGFP, subcloned into pCAG from Addgene #89446) plasmids to 3.5 µg/µL in molecular grade ddH2O with 5% sucrose and 0.1% Fast Green FCF ...
-
bioRxiv - Developmental Biology 2024Quote: ... Guide sequences were inserted into the Cas9–sgRNA plasmid (pDD162, Addgene #47549) using the NEB Q5 Site-Directed Mutagenesis Kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... The HDR plasmid containing ippk-1 homology arms and the GFP and selection cassette (pDD282, Addgene #66823) was made using Gibson Assembly as described in Dickinson et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the VSV-G envelope expressing plasmid pMD2.G (gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Developmental Biology 2024Quote: ... the third generation lentiviral pHAGE vector originally developed in the lab of Richard Mulligan86 was used together with the second generation lentiviral packaging plasmid psPAX2 (gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the VSV-G envelope expressing plasmid pMD2.G (gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... pCAG-EGFP-CAAX (Addgene #86056), pCAG-myr-mRFP (Addgene #32604) ...
-
bioRxiv - Developmental Biology 2024Quote: ... the third generation lentiviral pHAGE vector originally developed in the lab of Richard Mulligan86 was used together with the second generation lentiviral packaging plasmid psPAX2 (gift from Didier Trono (Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260)) and the VSV-G envelope expressing plasmid pMD2.G (gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Developmental Biology 2024Quote: ... pX330-SpCas9-HF1 was a gift from Yuichiro Miyaoka (Addgene plasmid#108301;http://n2t.net/addgene:108301 ...