Labshake search
Citations for Addgene :
1801 - 1850 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Each sgRNA was cloned in the plasmid pX459 (Addgene, #48139) and 8µg of each vector was used during mESCs transfection following the standard procedure for mESCs culture and genomic editing (Andrey and Spielmann ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... TetO-NGN2-eGFP-Puro plasmid (Addgene, #79823) using Polyethyleneimine (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... RSV (Addgene, #12253), pMDL (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... E2Crimson Mtb was generated by transformation with pTEC19 (Addgene 30178 ...
-
bioRxiv - Cell Biology 2024Quote: ... B16-F1 cells were transiently transfected with LifeAct-TagRed and PA-GFP-Actin (Addgene #57121) as described above ...
-
bioRxiv - Cell Biology 2024Quote: B16-F1 cells were transiently transfected with pEGFP-Paxillin (Addgene plasmid #15233) as described above and plated onto 35 mm glass-bottom Ibidi dishes coated with laminin ...
-
bioRxiv - Cell Biology 2024Quote: pGFP-EB1 (Addgene plasmid #17234) was transiently transfected into the B16-F1 control and Cyri-b KO cells and imaged live on a Zeiss 880 microscope with Airyscan with a Plan-Apochromat 63x/1.4 oil DIC objective lens with the 488nm laser at 1 image per second for 120 seconds ...
-
bioRxiv - Cell Biology 2024Quote: B16-F1 cells were transiently transfected with CYRI-B-p17-GFP and mCherry-β1 integrin (Addgene plasmid #55064) and plated on laminin coated glass bottom dishes ...
-
bioRxiv - Cell Biology 2024Quote: ... subsequently Dm-KHC(1-421)-SNAP-6xHis (gift from Kapitein lab, Addgene plasmid #196976) labelled with Alexa647-SNAP dye (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... envelope plasmid (Addgene plasmids were a gift of D ...
-
bioRxiv - Cell Biology 2024Quote: ... and pMD2.VSVG (Addgene, #12259) envelope plasmid (Addgene plasmids were a gift of D ...
-
bioRxiv - Cell Biology 2024Quote: ... the lentiviral psPAX packaging (Addgene, #12260) and pMD2.VSVG (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... Complementary gRNAs were annealed and subcloned into the pSpCas9(BB)-2A-GFP (pX-458) vector (#48138; Addgene) between BbsI endonuclease restriction sites ...
-
bioRxiv - Cell Biology 2024Quote: ... which was a gift from Kevin Janes (Addgene plasmid #136536; http://n2t.net/addgene:136536; RRID:Addgene_136536). Constructs were validated with Sanger sequencing before use ...
-
bioRxiv - Cell Biology 2024Quote: ... which was a gift from Kevin Janes (Addgene plasmid #136536 ...
-
bioRxiv - Cell Biology 2024Quote: ... The pmGFP-P2A-K0-P2A-RFP (Addgene #105686) and pmGFP-P2A-K20-P2A-RFP (Addgene #105688 ...
-
bioRxiv - Cell Biology 2024Quote: ... a LAMP1-mRFP plasmid (Addgene, 34611) was linearized using NdeI ...
-
bioRxiv - Cell Biology 2024Quote: ... Both Flox and iKO cells were transfected with 600ng of tfLC3 plasmid (Addgene, 21704) using Lipofectamine LTX (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 μg sgRNA plasmid (BPK1520, Addgene #65777), 7.5 μg pCMV_AncBE4max_P2A_GFP plasmid (for base-editing ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragment of tight TRE promoter with ATG start codon and 3XFLAG tag was amplified from pCW-Cas9 (Addgene #50661). The DNA fragment of hPGK-PuroR-rTetR was amplified from pCW-Cas9 ...
-
bioRxiv - Cell Biology 2024Quote: ... or pCAS9- mCherry-Frame +1 plasmid (for conventional CRISPR-Cas9, Addgene #66940), together with 10 μg PiggyBac transposon system (5 μg transposase + 5 μg hygromycin resistance containing transposon)8 were co-electroporated into human duodenum ...
-
bioRxiv - Cell Biology 2024Quote: ... 7.5 μg pCMV_AncBE4max_P2A_GFP plasmid (for base-editing, Addgene #112100) or pCAS9- mCherry-Frame +1 plasmid (for conventional CRISPR-Cas9 ...
-
bioRxiv - Cell Biology 2024Quote: ... spacer sequences for sgRNAs were cloned as previously described in the empty sgRNA backbone that was a kind gift from Keith Joung (BPK1520, Addgene #65777)7 ...
-
bioRxiv - Cell Biology 2024Quote: ... M2rtTA (Addgene, #20342), or the NGN2 overexpression vector ...
-
bioRxiv - Cell Biology 2024Quote: ... 3.62 µg pCMV-VSV-G (Plasmid #8454, Addgene), 8.28 µg psPAX2 (Plasmid #12260 ...
-
bioRxiv - Cell Biology 2024Quote: ... 8.28 µg psPAX2 (Plasmid #12260, Addgene), and 20 µg sgRNA plasmid and Opti-MEM (Thermo Fisher Scientific #11058021 ...
-
bioRxiv - Cell Biology 2024Quote: Lentivirus containing the genome-wide lentiviral sgRNA library (Addgene # 1000000100) was used to transduce 500 million K562 cells as previously described (Adelmann et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with pMD2.G (Addgene #12259), psPAX2 (Addgene #12260) ...
-
bioRxiv - Cell Biology 2024Quote: ... psPAX2 (Addgene #12260), and a lentiviral transfer plasmid (2:3:4 ratio by mass ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 µg LentiCRISPRv2-opti (Addgene #163126) was digested and dephosphorylated for 3 hours in a 60 µL reaction at 37 °C with FastDigest Esp3I and FastAP (ThermoFisher FD0454 and EF0654 ...
-
bioRxiv - Cell Biology 2024Quote: ... and all sgRNAs from an existing genome-wide library (Addgene # 1000000100) targeting each gene in the subset were included in the validation library (10 sgRNAs for most genes) ...
-
bioRxiv - Cell Biology 2024Quote: ... (GTGCTTCTCCGGTCCAGGCT) for Grip84 and Grip163 respectively were cloned into pCFD5 vector (Addgene, 112645) at Bbs1 restriction site using HiFi DNA Assembly Master Mix (E2621S ...
-
bioRxiv - Cell Biology 2024Quote: ... pmGFP-Sec16L was a gift from Benjamin Glick (Addgene plasmid # 15776 ...
-
bioRxiv - Cell Biology 2024Quote: Lentiviral-TOP/FOP-dGFP-reporters (wild-type consensus plasmid TOP: Addgene plasmid #14715 ...
-
bioRxiv - Cell Biology 2024Quote: Lentiviral-TOP/FOP-dGFP-reporters (wild-type consensus plasmid TOP: Addgene plasmid #14715; http://n2t.net/addgene:14715; RRID:Addgene_14715 ...
-
bioRxiv - Cell Biology 2024Quote: ... Str-KDEL_SBP-EGFP-Ecadherin was a gift from Franck Perez (Addgene plasmid # 65286 ...
-
bioRxiv - Cell Biology 2024Quote: Lentiviral-TOP/FOP-dGFP-reporters (wild-type consensus plasmid TOP: Addgene plasmid #14715; http://n2t.net/addgene:14715; RRID:Addgene_14715; inverted consensus plasmid FOP: Addgene plasmid # 14885 ...
-
bioRxiv - Cell Biology 2024Quote: ... Str-KDEL_SBP-EGFP-Ecadherin was a gift from Franck Perez (Addgene plasmid # 65286; http://n2t.net/addgene:65286; RRID:Addgene_65286).
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... the sgRNA spacers were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene #62988) as described previously (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... HYLS1 crRNA was cloned into the Lenti-CRISPR-V2 backbone (a gift from Feng Zhang; Addgene plasmid #52961) and transfected with the pCMV-VSV-G (a gift from Bob Weinberg ...
-
bioRxiv - Cell Biology 2024Quote: ... which was a gift from Kevin Janes (Addgene plasmid #136536 ...
-
bioRxiv - Cell Biology 2024Quote: ... which was a gift from Kevin Janes (Addgene plasmid #136536; http://n2t.net/addgene:136536; RRID:Addgene_136536), pCMV dR8.2 dvpr (Addgene 8455 ...
-
bioRxiv - Cell Biology 2024Quote: ... plk1 T210A was a gift from Michael Yaffe (Addgene plasmid # 132965 ...
-
bioRxiv - Cell Biology 2024Quote: ... plk1 T210A was a gift from Michael Yaffe (Addgene plasmid # 132965; http://n2t.net/addgene:132965; RRID:Addgene_132965). plk1 WT GFP-myc was a gift from Michael Yaffe (Addgene plasmid # 132963 ...
-
bioRxiv - Cell Biology 2024Quote: ... plk1 WT GFP-myc was a gift from Michael Yaffe (Addgene plasmid # 132963 ...
-
bioRxiv - Cell Biology 2024Quote: ... psPAX2 and pMD2G were obtained from Addgene. A C-terminal 19 aa truncated SARS-CoV-2 spike expression vector and CMV-eGF1 were kind gifts from Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... and pCMV-VSV-G (Addgene 8454, gift from Bob Weinberg) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... pCMV dR8.2 dvpr (Addgene 8455, gift from Bob Weinberg), and pCMV-VSV-G (Addgene 8454 ...