Labshake search
Citations for Addgene :
1601 - 1650 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... the HA-KDM4A (Addgene, Plasmid # 24180) construct was transfected using Lipofectamine2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with pEGFP-C1-Centrin-1 plasmid (Addgene, Plasmid # 72641) using Lipofectamine2000 according to the manufacture’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cell Biology 2024Quote: ... Iino (Addgene plasmid # 58216). The plasmid encoding TMEM192-GCAMP7 was constructed by cloning TMEM192 and GCAMP7 sequence into pcDNA 3.1/Zeo (+ ...
-
bioRxiv - Cell Biology 2024Quote: The CRY2olig-mCherry backbone vector was a gift from Chandra Tucker (Addgene plasmid # 60032) (Taslimi et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... pEX-CMV-SP-YFP-STIM2(15-746) EF hand D80A was a gift from Tobias Meyer (Addgene plasmid # 18864 ...
-
bioRxiv - Cell Biology 2024Quote: ... pEX-CMV-SP-YFP-STIM2(15-746) EF hand D80A was a gift from Tobias Meyer (Addgene plasmid # 18864; http://n2t.net/addgene:18864; RRID:Addgene_18864). N-glycosidase F (PNGaseF ...
-
bioRxiv - Cell Biology 2024Quote: ... The pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene, #62988) was linearised using by BbsI-HF (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with a mixture of pSpCas9(BB)-2A-GFP plasmids (gift from Feng Zhang; Addgene plasmid #48138) containing two different sgRNA sequences (TTGGATGACTCGGACTCGCT and CGCTTGGTGATTCCATGTAA ...
-
bioRxiv - Cell Biology 2024Quote: ... Mis18BP11-490 was cloned from a codon optimised sequence (GeneArt) into the pET His6 MBP TEV (14C, Addgene plasmid #48309 ...
-
bioRxiv - Cell Biology 2024Quote: ... Mis18α and Mis18β genes were cloned into expression vectors pET His6 TEV (9B) and pET His6 msfGFP TEV (9GFP, Addgene plasmids #48284 and #48287 ...
-
bioRxiv - Cell Biology 2024Quote: ... Mis18BP1 and HJURP were cloned into pcDNA3 mCherry and pcDNA3 GFP vectors (6B and 6D, Addgene plasmids #30125 and #30127 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentivirus was produced from pLenti-SV40-T-tsA58 (abm cat# LV629) as previously described (51) using the VSV envelope from pMD2.G (Addgene cat#12259, gift from Didier Trono) and the packaging plasmid pCMV delta R8.2 (Addgene cat # 12263 ...
-
bioRxiv - Cell Biology 2024Quote: ... and the packaging plasmid pCMV delta R8.2 (Addgene cat # 12263, gift from Didier Trono). Primary glomerular outgrowths were infected for 48 hours followed by selection with puromycin (2ug/ml) ...
-
Pyruvate kinase M2 regulates Japanese encephalitis virus replication by interacting with NS1 proteinbioRxiv - Microbiology 2024Quote: The following plasmids were used in the current study: pEGFP.PKM2 (Addgene #64698) and pEGFP (Addgene #165830) ...
-
Pyruvate kinase M2 regulates Japanese encephalitis virus replication by interacting with NS1 proteinbioRxiv - Microbiology 2024Quote: The plasmid used in this study pEGFP-PKM2 (Addgene #64698) is a generous gift from Axel Ullrich lab ...
-
bioRxiv - Immunology 2024Quote: ... together with the packaging vectors psPAX2 and pMD2.G (Addgene plasmids 12260 and 12259 by Didier Trono ...
-
bioRxiv - Immunology 2024Quote: ... HEK293T cells were transfected with the lentiviral vector pScalps-EGFP-Cre recombinase (7) (Addgene plasmid 207132) together with the packaging vectors psPAX2 and pMD2.G (Addgene plasmids 12260 and 12259 by Didier Trono ...
-
bioRxiv - Microbiology 2024Quote: ... coli MG-1655 cells harboring the pEB1-mGFPmut2 plasmid where used throughout the study (pEB1-mGFPmut2 was a gift from Philippe Cluzel, Addgene plasmid #103980; http://n2t.net/addgene:103980; RRID: Addgene_103980)74 ...
-
bioRxiv - Microbiology 2024Quote: HeLa-TetR-Cas9 clonal cells used in the genome-wide screen and polyclonal Huh7 cells transduced with 311-Cas9 (Plasmid Addgene #96924) and selected using 10 µg/mL blasticidin for 7 days were used for secondary screening ...
-
bioRxiv - Genomics 2024Quote: ... we used a SaCas9 and GFP-containing backbone (Addgene #118836, plasmid pTRI211) into which was cloned the SaCas9-CTG sgRNA to give plasmid pTRI 212.
-
bioRxiv - Genomics 2024Quote: ... the left TALEN arm was cloned into pHR’CMVGFP_hRIF1(1924- 2446)IREShygro3 (Addgene #23138) to give plasmid pTRI204 ...
-
bioRxiv - Genomics 2024Quote: ... The left recoded arm was cloned in pHR’CMVGFP_hRIF1(1924-2446)IREShygro3 (Addgene #23138) at BamHI and XhoI to give plasmid pTRI213 ...
-
bioRxiv - Genetics 2024Quote: ... pCMV_ABEmax_P2A_GFP (Addgene plasmid # 112101) was a gift from David Liu ...
-
bioRxiv - Genetics 2024Quote: ... and pMD2.G (Addgene plasmid # 12259) were a gift from Didier Trono ...
-
bioRxiv - Genetics 2024Quote: ... MLM3636 (Addgene plasmid # 43860) was a gift from Keith Joung ...
-
bioRxiv - Genetics 2024Quote: ... pDT-sgRNA (Addgene# 138271) vector was selected as gRNA carrier ...
-
bioRxiv - Genomics 2024Quote: ... Lenti_gRNA-Puro (Addgene #84752). The dual-pegRNA lentiviral vector ...
-
bioRxiv - Genomics 2024Quote: ... a lentiviral vector was prepared by PCR amplification of the corresponding cassettes from pCMV-PEmax-P2A-hMLH1dn and subsequent insertion into pLenti-PE2-BSD (Addgene #161514), which had been digested with EcoRI and XbaI (#R0145S & #R3101S ...
-
bioRxiv - Genomics 2024Quote: ... The pU6_pegRNA-GG-Acceptor plasmid (Addgene #132777) was modified to exchange the mRFP1 cassette with a BsmBI cloning cassette ...
-
bioRxiv - Genomics 2024Quote: For transient co-expression of PEmax and MLH1dn we used the pCMV-PEmax-P2A-hMLH1dn plasmid (Addgene #174828). The pU6_pegRNA-GG-Acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Genomics 2024Quote: ... and 6 were generated from pSpCas9(BB)-2A-Puro (PX459 V2.0, Addgene #62988) via insertion of spacer sequences into the BbsI cloning site (#R3539L ...
-
bioRxiv - Genomics 2024Quote: ... flanking the region of interest were designed using CRISPOR (http://crispor.tefor.net/) to be further introduced either into pX458 or pX459 vectors from Addgene (each vector contains one gRNA). pX458 and pX459 vectors were previously digested 2hours at 37°C by BbsI (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Plasmid harboring mVenus was obtained from Addgene (catalogue no.: 103986) and mTurquiose2 was a gift from Ondrej Havranek (coding sequence corresponding to Addgene catalogue no. ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas929 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we co-transformed them with a pCAS plasmid (Addgene) targeting the HPH marker and the eGFP sequence with homology arms for each locus50 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas9 with the PCR amplified MYO3 and MYO5 SH3 single position mutated libraries from the pUC19 preparations acting as the donor DNA29 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we first replaced the SH3 domain with a flexible linker (GGSSGGGG) using yeast competent cells that were co-transformed with a pCAS plasmid (Addgene plasmid 60847) expressing both the gRNA of interest and Streptococcus pyogenes Cas9 and a donor DNA sequence (stuffer ...
-
bioRxiv - Genomics 2024Quote: ... with either UniSAM empty vector (Addgene #99866) or UniSAM vector containing sgRNA targeting LEPR AFE2 promoter region (3 replicates per condition)48 ...
-
bioRxiv - Genetics 2024Quote: ... the antisense plasmid (SP505) and a BxB1-encoding plasmid (SP225, Addgene #51271) were transfected with Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... or pMMLV-mRFP1-P2A-Puro (both were a kind gift from Jason Sheltzer (Addgene plasmid #160227; http://n2t.net/addgene:160227; RRID:Addgene 160227) (Addgene plasmid #160228 ...
-
bioRxiv - Genetics 2024Quote: ... The corresponding gRNA sequences were cloned into the pX330-U6-Chimeric BB-CBh-hSpCas9 backbone (gift from Feng Zhang; Addgene plasmid #42230) using BbsI (NEB ...
-
bioRxiv - Genetics 2024Quote: ... or pMMLV-mRFP1-P2A-Puro (both were a kind gift from Jason Sheltzer (Addgene plasmid #160227 ...
-
bioRxiv - Genetics 2024Quote: ... or pMMLV-mRFP1-P2A-Puro (both were a kind gift from Jason Sheltzer (Addgene plasmid #160227; http://n2t.net/addgene:160227; RRID:Addgene 160227) (Addgene plasmid #160228 ...
-
bioRxiv - Genetics 2024Quote: ... a fragment cleaved from EF1a Puro Telo v1 (gift from Jason Sheltzer; Addgene plasmid #195138), which encodes a puromycin resistance cassette fused to a telomeric sequence ...
-
bioRxiv - Genetics 2024Quote: ... RRID:Addgene 160227) (Addgene plasmid #160228; http://n2t.net/addgene:160228 ; RRID:Addgene 160228)) by using Lipofectamine™ 2000 (Life Technologies ...
-
bioRxiv - Genetics 2024Quote: ... pRSV-Rev (Addgene plasmid # 12253) and pMD2.G (Addgene plasmid # 12259 ...
-
bioRxiv - Genetics 2024Quote: pX330-U6-Chimeric_BB-CBh-hSpCas9 (pX330) (Addgene plasmid # 42230) was a gift from Feng Zhang ...
-
bioRxiv - Genetics 2024Quote: ... Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR (Addgene plasmid # 118154) was a gift from Jorge Ferrer ...