Labshake search

1601 - 1650 of 10000+ citations since 2020

• Autophagosome turnover requires Arp2/3 complex-mediated maintenance of lysosomal integrity

  Corey J. Theodore, et al., bioRxiv - Cell Biology 2024

  Quote: ... Both Flox and iKO cells were transfected with 600ng of tfLC3 plasmid (Addgene, 21704) using Lipofectamine LTX (Invitrogen ...
• Tuft cells act as regenerative stem cells in the human intestine

  Lulu Huang, et al., bioRxiv - Cell Biology 2024

  Quote: ... 2.5 μg sgRNA plasmid (BPK1520, Addgene #65777), 7.5 μg pCMV_AncBE4max_P2A_GFP plasmid (for base-editing ...
• Tuft cells act as regenerative stem cells in the human intestine

  Lulu Huang, et al., bioRxiv - Cell Biology 2024

  Quote: ... The DNA fragment of tight TRE promoter with ATG start codon and 3XFLAG tag was amplified from pCW-Cas9 (Addgene #50661). The DNA fragment of hPGK-PuroR-rTetR was amplified from pCW-Cas9 ...
• Tuft cells act as regenerative stem cells in the human intestine

  Lulu Huang, et al., bioRxiv - Cell Biology 2024

  Quote: ... or pCAS9- mCherry-Frame +1 plasmid (for conventional CRISPR-Cas9, Addgene #66940), together with 10 μg PiggyBac transposon system (5 μg transposase + 5 μg hygromycin resistance containing transposon)8 were co-electroporated into human duodenum ...
• Tuft cells act as regenerative stem cells in the human intestine

  Lulu Huang, et al., bioRxiv - Cell Biology 2024

  Quote: ... 7.5 μg pCMV_AncBE4max_P2A_GFP plasmid (for base-editing, Addgene #112100) or pCAS9- mCherry-Frame +1 plasmid (for conventional CRISPR-Cas9 ...
• Tuft cells act as regenerative stem cells in the human intestine

  Lulu Huang, et al., bioRxiv - Cell Biology 2024

  Quote: ... spacer sequences for sgRNAs were cloned as previously described in the empty sgRNA backbone that was a kind gift from Keith Joung (BPK1520, Addgene #65777)7 ...
• Alzheimer’s disease induced neurons bearing PSEN1 mutations exhibit reduced excitability

  Simon Maksour, et al., bioRxiv - Cell Biology 2024

  Quote: ... M2rtTA (Addgene, #20342), or the NGN2 overexpression vector ...
• Functional genetics reveals modulators of anti-microtubule drug sensitivity

  Kuan-Chung Su, et al., bioRxiv - Cell Biology 2024

  Quote: ... 3.62 µg pCMV-VSV-G (Plasmid #8454, Addgene), 8.28 µg psPAX2 (Plasmid #12260 ...
• Functional genetics reveals modulators of anti-microtubule drug sensitivity

  Kuan-Chung Su, et al., bioRxiv - Cell Biology 2024

  Quote: ... 8.28 µg psPAX2 (Plasmid #12260, Addgene), and 20 µg sgRNA plasmid and Opti-MEM (Thermo Fisher Scientific #11058021 ...
• Functional genetics reveals modulators of anti-microtubule drug sensitivity

  Kuan-Chung Su, et al., bioRxiv - Cell Biology 2024

  Quote: Lentivirus containing the genome-wide lentiviral sgRNA library (Addgene # 1000000100) was used to transduce 500 million K562 cells as previously described (Adelmann et al. ...
• Functional genetics reveals modulators of anti-microtubule drug sensitivity

  Kuan-Chung Su, et al., bioRxiv - Cell Biology 2024

  Quote: ... cells were transfected with pMD2.G (Addgene #12259), psPAX2 (Addgene #12260) ...
• Functional genetics reveals modulators of anti-microtubule drug sensitivity

  Kuan-Chung Su, et al., bioRxiv - Cell Biology 2024

  Quote: ... psPAX2 (Addgene #12260), and a lentiviral transfer plasmid (2:3:4 ratio by mass ...
• Functional genetics reveals modulators of anti-microtubule drug sensitivity

  Kuan-Chung Su, et al., bioRxiv - Cell Biology 2024

  Quote: ... 10 µg LentiCRISPRv2-opti (Addgene #163126) was digested and dephosphorylated for 3 hours in a 60 µL reaction at 37 °C with FastDigest Esp3I and FastAP (ThermoFisher FD0454 and EF0654 ...
• Functional genetics reveals modulators of anti-microtubule drug sensitivity

  Kuan-Chung Su, et al., bioRxiv - Cell Biology 2024

  Quote: ... and all sgRNAs from an existing genome-wide library (Addgene # 1000000100) targeting each gene in the subset were included in the validation library (10 sgRNAs for most genes) ...
• A Hollow TFG Condensate Spatially Compartmentalizes the Early Secretory Pathway

  William R. Wegeng, et al., bioRxiv - Cell Biology 2024

  Quote: ... pmGFP-Sec16L was a gift from Benjamin Glick (Addgene plasmid # 15776 ...
• Intracellular pH regulates β-catenin with low pHi increasing adhesion and signaling functions

  Brandon J. Czowski, Katharine A. White, bioRxiv - Cell Biology 2024

  Quote: Lentiviral-TOP/FOP-dGFP-reporters (wild-type consensus plasmid TOP: Addgene plasmid #14715 ...
• Intracellular pH regulates β-catenin with low pHi increasing adhesion and signaling functions

  Brandon J. Czowski, Katharine A. White, bioRxiv - Cell Biology 2024

  Quote: Lentiviral-TOP/FOP-dGFP-reporters (wild-type consensus plasmid TOP: Addgene plasmid #14715; http://n2t.net/addgene:14715; RRID:Addgene_14715 ...
• A Hollow TFG Condensate Spatially Compartmentalizes the Early Secretory Pathway

  William R. Wegeng, et al., bioRxiv - Cell Biology 2024

  Quote: ... Str-KDEL_SBP-EGFP-Ecadherin was a gift from Franck Perez (Addgene plasmid # 65286 ...
• Intracellular pH regulates β-catenin with low pHi increasing adhesion and signaling functions

  Brandon J. Czowski, Katharine A. White, bioRxiv - Cell Biology 2024

  Quote: Lentiviral-TOP/FOP-dGFP-reporters (wild-type consensus plasmid TOP: Addgene plasmid #14715; http://n2t.net/addgene:14715; RRID:Addgene_14715; inverted consensus plasmid FOP: Addgene plasmid # 14885 ...
• A Hollow TFG Condensate Spatially Compartmentalizes the Early Secretory Pathway

  William R. Wegeng, et al., bioRxiv - Cell Biology 2024

  Quote: ... Str-KDEL_SBP-EGFP-Ecadherin was a gift from Franck Perez (Addgene plasmid # 65286; http://n2t.net/addgene:65286; RRID:Addgene_65286).
• CYRI-B loss promotes enlarged mature focal adhesions and restricts microtubule and ERC1 access to the cell leading edge

  Jamie A. Whitelaw, et al., bioRxiv - Cell Biology 2024

  Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
• Loss of KIF13B causes time-dependent changes in ciliary polycystin-2 levels and extracellular vesicle release

  Csenge K. Rezi, et al., bioRxiv - Cell Biology 2024

  Quote: ... the sgRNA spacers were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene #62988) as described previously (Ran et al. ...
• Centriole structural integrity defects are a crucial feature of Hydrolethalus Syndrome

  Ana Curinha, et al., bioRxiv - Cell Biology 2024

  Quote: ... HYLS1 crRNA was cloned into the Lenti-CRISPR-V2 backbone (a gift from Feng Zhang; Addgene plasmid #52961) and transfected with the pCMV-VSV-G (a gift from Bob Weinberg ...
• Chk2 sustains PLK1 activity in mitosis to ensure proper chromosome segregation

  Elizabeth M. Black, et al., bioRxiv - Cell Biology 2024

  Quote: ... which was a gift from Kevin Janes (Addgene plasmid #136536 ...
• Chk2 sustains PLK1 activity in mitosis to ensure proper chromosome segregation

  Elizabeth M. Black, et al., bioRxiv - Cell Biology 2024

  Quote: ... which was a gift from Kevin Janes (Addgene plasmid #136536; http://n2t.net/addgene:136536; RRID:Addgene_136536), pCMV dR8.2 dvpr (Addgene 8455 ...
• Chk2 sustains PLK1 activity in mitosis to ensure proper chromosome segregation

  Elizabeth M. Black, et al., bioRxiv - Cell Biology 2024

  Quote: ... plk1 T210A was a gift from Michael Yaffe (Addgene plasmid # 132965 ...
• Chk2 sustains PLK1 activity in mitosis to ensure proper chromosome segregation

  Elizabeth M. Black, et al., bioRxiv - Cell Biology 2024

  Quote: ... plk1 T210A was a gift from Michael Yaffe (Addgene plasmid # 132965; http://n2t.net/addgene:132965; RRID:Addgene_132965). plk1 WT GFP-myc was a gift from Michael Yaffe (Addgene plasmid # 132963 ...
• Chk2 sustains PLK1 activity in mitosis to ensure proper chromosome segregation

  Elizabeth M. Black, et al., bioRxiv - Cell Biology 2024

  Quote: ... plk1 WT GFP-myc was a gift from Michael Yaffe (Addgene plasmid # 132963 ...
• SARS-CoV-2 remodels the Golgi apparatus to facilitate viral assembly and secretion

  Jianchao Zhang, et al., bioRxiv - Cell Biology 2024

  Quote: ... psPAX2 and pMD2G were obtained from Addgene. A C-terminal 19 aa truncated SARS-CoV-2 spike expression vector and CMV-eGF1 were kind gifts from Dr ...
• Chk2 sustains PLK1 activity in mitosis to ensure proper chromosome segregation

  Elizabeth M. Black, et al., bioRxiv - Cell Biology 2024

  Quote: ... and pCMV-VSV-G (Addgene 8454, gift from Bob Weinberg) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen ...
• Chk2 sustains PLK1 activity in mitosis to ensure proper chromosome segregation

  Elizabeth M. Black, et al., bioRxiv - Cell Biology 2024

  Quote: ... pCMV dR8.2 dvpr (Addgene 8455, gift from Bob Weinberg), and pCMV-VSV-G (Addgene 8454 ...
• Chk2 sustains PLK1 activity in mitosis to ensure proper chromosome segregation

  Elizabeth M. Black, et al., bioRxiv - Cell Biology 2024

  Quote: ... plk1 WT GFP-myc was a gift from Michael Yaffe (Addgene plasmid # 132963; http://n2t.net/addgene:132963; RRID:Addgene_132963).
• The Role of Nde1 Phosphorylation in Interkinetic Nuclear Migration and Schizophrenia

  David J Doobin, et al., bioRxiv - Developmental Biology 2024

  Quote: ... mouse cDNA for Nde1 was cloned into a mCherry fluorescent reporter (mCherry-C1-NDE1) and subcloned into a pCAGEN vector driven by CAG promoter (provided by Connie Cepko (Addgene plasmid #11160)) using XhoI and NotI restriction sites ...
• A Hollow TFG Condensate Spatially Compartmentalizes the Early Secretory Pathway

  William R. Wegeng, et al., bioRxiv - Cell Biology 2024

  Quote: ... pmGFP-Sec16L was a gift from Benjamin Glick (Addgene plasmid # 15776; http://n2t.net/addgene:15776; RRID:Addgene_15776). Str-KDEL_SBP-EGFP-Ecadherin was a gift from Franck Perez (Addgene plasmid # 65286 ...
• A high throughput CRISPR perturbation screen identifies epigenetic regulators impacting primordial germ cell development

  Liangdao Li, et al., bioRxiv - Developmental Biology 2024

  Quote: The plasmids psPax2 (Addgene; 12260) and pMD2.G (Addgene ...
• Spatiotemporal dynamics of NF-κB/Dorsal inhibitor IκBα/Cactus in Drosophila blastoderm embryos

  Allison E. Schloop, et al., bioRxiv - Developmental Biology 2024

  Quote: ... Plasmids used in this protocol were gifted from Kate O’Connor-Giles (Addgene plasmids #45946 and #51434)(Gratz et al. ...
• Centriole structural integrity defects are a crucial feature of Hydrolethalus Syndrome

  Ana Curinha, et al., bioRxiv - Cell Biology 2024

  Quote: ... and the psPAX2 (a gift from Didier Trono, Addgene plasmid #12260), in HEK 293T cells using calcium phosphate ...
• Centriole structural integrity defects are a crucial feature of Hydrolethalus Syndrome

  Ana Curinha, et al., bioRxiv - Cell Biology 2024

  Quote: ... and transfected with the pCMV-VSV-G (a gift from Bob Weinberg, Addgene plasmid #8454) and the psPAX2 (a gift from Didier Trono ...
• Metabolic and age-associated epigenetic barriers during direct reprogramming of mouse fibroblasts into induced cardiomyocytes

  Francisco Santos, et al., bioRxiv - Cell Biology 2024

  Quote: ... either pMX-puro-MGT (Addgene, #111809), a polycistronic vector that expresses the reprogramming factors Mef2c ...
• Metabolic and age-associated epigenetic barriers during direct reprogramming of mouse fibroblasts into induced cardiomyocytes

  Francisco Santos, et al., bioRxiv - Cell Biology 2024

  Quote: ... Gata4 and Tbx5 (MGT) or pBabe-puro (an emptyback bone vector, used as mock/control; Addgene, #1784) were mixed with 4 μg pCL-Ampho (retroviral packaging plasmid) ...
• A cellular assay to determine the fusion capacity of MFN2 variants linked to Charcot-Marie-Tooth type 2A

  Chloe Barsa, et al., bioRxiv - Cell Biology 2024

  Quote: ... was either mutagenized in a 3 kb cloning plasmid (pKSPS (Bahri et al., 2021)) before subcloning into pQCXIB (the retroviral expression vector, Addgene plasmid #22800) or was directly mutagenized in pQCXIB ...
• The USH3A causative gene clarin1 functions in Müller glia to maintain retinal photoreceptors

  Hannah J. T. Nonarath, et al., bioRxiv - Cell Biology 2024

  Quote: ... a pME-Lifeact (65) plasmid was a gift from Rob Parton (Addgene plasmid #109545). Using gateway cloning ...
• CRISPR-Cas9 editing efficiency in fission yeast is not limited by homology search and is improved by combining gap-repair with fluoride selection

  Ronan Fernandez, Julien Berro, bioRxiv - Cell Biology 2024

  Quote: The vector pJB166 (Addgene #86998) expressing SpCas9 under the adh1 promoter ...
• 3D live imaging and phenotyping of the subcellular cytotoxicity in cancer immunotherapy using event-triggered Bessel oblique plane microscopy

  Zhaofei Wang, et al., bioRxiv - Immunology 2024

  Quote: ... mTagRFP-Membrane-1 was a gift from Michael Davidson (Addgene plasmid # 57992), and we replaced mTagRFP with mApple to construct the mApple-Mem plasmid ...
• Human long noncoding RNA, VILMIR, is induced by major respiratory viral infections and modulates the host interferon response

  Kristen John, et al., bioRxiv - Immunology 2024

  Quote: The dCas9-KRAB construct was ordered from Addgene (#89567). The GFP construct for overexpression was constructed from a pSico lentiviral backbone with a bidirectional minimal EF1A-minimal CMV promoter expressing T2A flanked genes ...
• Human long noncoding RNA, VILMIR, is induced by major respiratory viral infections and modulates the host interferon response

  Kristen John, et al., bioRxiv - Immunology 2024

  Quote: ... and pMD2.G (Addgene #12259) using the Lipofectamine 3000 Reagent (Invitrogen) ...
• Human long noncoding RNA, VILMIR, is induced by major respiratory viral infections and modulates the host interferon response

  Kristen John, et al., bioRxiv - Immunology 2024

  Quote: ... psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
• IFNγ-dependent remodelling of the myeloid landscape underlies control of IFNγ-insensitive tumours

  Vivian W.C. Lau, et al., bioRxiv - Immunology 2024

  Quote: ... the single guide RNA (sgRNA) sequences targeting exon 1 or 2 of murine IFNγR1 were cloned into the pX458 backbone (Addgene) containing Cas9 expression and GFP expression ...
• Engineering self-propelled tumor-infiltrating CAR T cells using synthetic velocity receptors

  Adrian C. Johnston, et al., bioRxiv - Immunology 2024

  Quote: ... using the backbone pSLCAR-CD19-BBz (Addgene). VR nucleic acids were synthetically constructed as indicated (refer to Fig ...
• Randomizing the human genome by engineering recombination between repeat elements

  Jonas Koeppel, et al., bioRxiv - Genomics 2024

  Quote: ... The pegRNA acceptor plasmid (Addgene #132777) was linearized with BsaI ...