Labshake search
Citations for Addgene :
1651 - 1700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and AAV1.Syn.Flex.tdTomato (Addgene 28306 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 20% Cre-dependent GCaMP6f (AAV.CAG.Flex.GCaMP6f.WPRE.SV4089; Addgene, #100835). For SK2-KO mice ...
-
bioRxiv - Neuroscience 2024Quote: All mice were injected bilaterally with AAV9-syn-FLEX-jGCaMP7s-WPRE (Addgene, 104491-AAV9) in the AIC at coordinates A/P ...
-
bioRxiv - Neuroscience 2024Quote: ... ±2.25, D/V: −3.10 (100 nl/injection, 25 nl/min infusion rate) and AAVrg-Ef1a-mCherry-IRES-Cre (Addgene, 55632-AAVrg) in the DLS at coordinates A/P ...
-
bioRxiv - Neuroscience 2024Quote: ... QF2 was amplified from Gbait-hsp70-QF2-pA (Addgene plasmid #122563 ...
-
bioRxiv - Neuroscience 2024Quote: ... pT3TS-nCas9n template DNA (Addgene, plasmid #46757; Jao et al., 2013) was digested with XbaI (R0145S ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting DNA was cloned into the pDR274 vector (Addgene, plasmid #42250; Hwang et al., 2013) following digestion of pDR274 with BsaI (R3733S ...
-
bioRxiv - Genetics 2024Quote: ... The fragment was subcloned into pPD49.83 (a gift from Andrew Fire, Addgene plasmid # 1448 ...
-
bioRxiv - Genetics 2024Quote: ... pHT101 (a gift from Casonya Johnson, Addgene plasmid # 61021; http://n2t.net/addgene:61021; RRID: Addgene_61021) using Pst1 and Age1 restriction sites ...
-
bioRxiv - Genetics 2024Quote: ... pHT101 (a gift from Casonya Johnson, Addgene plasmid # 61021 ...
-
bioRxiv - Genetics 2024Quote: ... The fragment was subcloned into pPD49.83 (a gift from Andrew Fire, Addgene plasmid # 1448; http://n2t.net/addgene:1448 ; RRID:Addgene_1448) using BamH1 and Nco1 restriction sites ...
-
The haplolethal gene wupA of Drosophila exhibits potential as a target for an X-poisoning gene drivebioRxiv - Genetics 2024Quote: The design protocol of Port and Bullock (2016) was used to clone gRNA sequences into the pCFD5_w plasmid (Addgene #112645). Three separate plasmids were generated that targeted haplolethal genes on the X chromosome ...
-
bioRxiv - Biochemistry 2024Quote: Biotinylated proteins were co-expressed with BirA (PET21a-BirA, Addgene #20857) in E ...
-
bioRxiv - Developmental Biology 2024Quote: ... which was then cloned into pENTR-dTOPO (Thermo) for Gateway cloning into PB-TA-ERN (Knut Woltjen, Addgene #80474, (Kim et al., 2016)) to generate PB-TA-ERN-hTFAP2A(CR)-HA ...
-
bioRxiv - Developmental Biology 2024Quote: ... The TFAP2A gRNA targeted site of human TFAP2A construct (gift of Robert Tjian, Addgene #12100, (Williams and Tjian, 1991)) was mutated using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and REV (RRID:Addgene_22036) using Lipofectamine 3000 reagent (Invitrogen™ ...
-
bioRxiv - Cancer Biology 2024Quote: ... 293T cells were co-transfected with lentiCRISPR v2 construct and the second-generation lentiviral packaging plasmids pMD2.G for VSV-G (RRID:Addgene_12259) and pCMVR8.74 for GAG ...
-
bioRxiv - Developmental Biology 2024Quote: ... sgRNA oligos targeting the C-terminal region of target genes were cloned into the pX330 Cas9/sgRNA expression plasmid (Addgene 42230). For generation of the reporter line ...
-
The haplolethal gene wupA of Drosophila exhibits potential as a target for an X-poisoning gene drivebioRxiv - Genetics 2024Quote: ... attP40{nos-Cas9}/CyO which carries a recessive lethal allele on the second chromosome and cannot be made homozygous) or (ii) a line we generated that has nos-Cas9 (from Addgene plasmid 62208 courtesy of Simon Bullock which has a single NLS and a 3’UTR from nanos ...
-
bioRxiv - Cell Biology 2024Quote: ... AICSDP-82:SON-mEGFP was a gift from Allen Institute for Cell Science (Addgene plasmid # 133964 ...
-
bioRxiv - Cell Biology 2024Quote: ... pECFP(C1)-NIPP1 (Addgene plasmid # 44226; http://n2t.net/addgene:44226; RRID:Addgene_44226), pEGFP(C1)-PP1alpha (Addgene plasmid # 44224 ...
-
bioRxiv - Cell Biology 2024Quote: ... APEX2-NLS was a gift from Alice Ting (Addgene plasmid # 124617 ...
-
bioRxiv - Neuroscience 2024Quote: pEGFP-Q23 and pEGFP-Q74 plasmids were a gift from David Rubinsztein (Addgene plasmid # 40261 and 40262) [44] ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligos were designed and cloned into the CRISPRi-v2 sgRNA plasmid pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene plasmid #60955) using sequences from (Horlbeck et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... in 200 uL of OptiMEM with 0.8 ug of the I-SceI expression plasmid (pCBASce, Addgene #60960). The media was replaced the next morning and the cells were trypsinized 48-hours post-transfection for analysis of GFP expression by flow cytometry (BD Biosciences).
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with lentivirus generated from the PIP-FUCCI plasmid (Addgene plasmid #138715) as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 10 sgRNAs per gene (hCRISPRi-v2; both the “top5” and “supp5” libraries from Addgene #1000000090) were prepared as described in (Palmer et al. ...
-
bioRxiv - Synthetic Biology 2024Quote: All mammalian plasmids expressing Cas9 and deadCas9-fused transcriptional activators were acquired from Addgene: dCas9-Vp64 (#47107) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The fragments were inserted into an XhoI and PsyI linearized plasmid (Addgene #112685) harboring the Cas9-T2A-eGFP expression cassette and an Opie2-DsRed marker ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The plasmid backbone (pU6-pegRNA-GG-acceptor, Addgene #132777) was digested using BsaI-HFv2 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 375 ng of PE4max enzyme plasmid (Addgene #174828), 62.5 ng of crRNA plasmid ...
-
bioRxiv - Plant Biology 2024Quote: ... plasmids were obtained from Addgene or were kindly provided by Dr ...
-
bioRxiv - Microbiology 2024Quote: ... Bru-GFP ΔENV was generated as previously described (63) with pmD2.G (Addgene).
-
bioRxiv - Microbiology 2024Quote: ... pHelper and pAAV-2.5 capsid plasmids were used (Addgene and (16). For VLP production ...
-
bioRxiv - Microbiology 2024Quote: ... psPAX2 and pmD2.G were used (Addgene). For HIV-1 ΔENV production ...
-
bioRxiv - Genomics 2024Quote: ... we nucleofected five million cells with five µg of spCas9/sgRNA-expression plasmids (pX330-U6-Chimeric-BB-CBh-hSpCas9, Addgene #42230) by Nucleofector 2b ...
-
bioRxiv - Genomics 2024Quote: ... and then cloned into the EagI and EcoRI sites of pJK03 (AddGene #173,490) in multiple ligation reactions (NEB T4 ligase) ...
-
bioRxiv - Genomics 2024Quote: ... Basal promoter inserts were prepared by amplifying the Rho basal promoter and DsRed from the plasmid pJK01 (AddGene #173,489) using the forward primer MO566 and reverse primers that add 9bp multiplexing barcodes (mBC ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse vsv-plexin-B3 and human pECE-M2-BAIAP2 (IRSP53-Flag) were purchased from Addgene (#68038, #68039, #31656, USA).
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... Vectors used are listed in Key Resources Table (Addgene #99378 ...
-
bioRxiv - Neuroscience 2024Quote: ... The following AAV vectors were purchased from Addgene: AAV5-hSyn-DIO-hM3D(Gq)-mCherry (#44361) ...
-
bioRxiv - Neuroscience 2024Quote: ... Olig001 was a gift from Thomas McCown (Addgene plasmid # 170716; http://n2t.net/addgene:170716; RRID:Addgene_170716)79.
-
bioRxiv - Neuroscience 2024Quote: ... pAAV.CAG.GCaMP6f.WPRE.SV40 was a gift from Douglas Kim & GENIE Project (Addgene viral prep # 100836-AAV1 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV.CAG.GCaMP6f.WPRE.SV40 was a gift from Douglas Kim & GENIE Project (Addgene viral prep # 100836-AAV1; http://n2t.net/addgene:100836; RRID:Addgene_100836)78 ...
-
bioRxiv - Neuroscience 2024Quote: ... and co-expressed it with CAG::Cre (Addgene: #13775) plasmid wt/wt = 30:1 for in utero electroporation ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-Syn-FLEX-rc [ChrimsonR-tdTomato] (FLEX-Chrimson, 1.20e+13 gc/mL, 250 nL, Addgene #62723-AAV5), AAVrg-hSyn-Cre-WPRE-hGH (retro-Cre ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-hSyn-Cre-WPRE-hGH (retro-Cre, 2.10e+13 gc/mL, 80 nL, Addgene #105553-AAVrg), AAV1-Syn-Chronos-GFP (Chronos ...
-
bioRxiv - Neuroscience 2024Quote: ... To optimize expression and dendritic membrane trafficking we designed the construct CAG::LR-Voltron2-TS-ER2-p2a-LR-CheRiff-TS-eYFP-ER2 (Addgene: #203228). In this construct ...