Labshake search
Citations for Addgene :
1451 - 1500 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: Cells were transfected with the following expression plasmids: eGFP-NLS (67652, Addgene), pCDH-CMV-hLamin_A-IRES-copGFP-EF1-puro (132773 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were co-transfected with plasmids encoding a mixture of viral packaging proteins VSV-G (12259, Addgene), viral backbone psPAX2 plasimd (12260 ...
-
bioRxiv - Biochemistry 2024Quote: ... viral backbone psPAX2 plasimd (12260, Addgene) and V5-APEX2-SENP2 (129276 ...
-
bioRxiv - Biochemistry 2024Quote: ... pCDH-CMV-hLamin_A-IRES-copGFP-EF1-puro (132773, Addgene), using JetOptimus transfection reagent (117-01 ...
-
bioRxiv - Biochemistry 2024Quote: ... and V5-APEX2-SENP2 (129276, Addgene) at ratio 3:2:4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... with pMaCTag-Z11 (Addgene# 120054) as a template DNA ...
-
bioRxiv - Neuroscience 2024Quote: ... 400ng or “filler DNA” expressing Gal4 (pPK-101) and 100ng of iCre plasmid (Addgene #116755). Nucleofection was performed using the EM-110 nucleofector program ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-CaMKIIa-mCherry (Addgene: AAV1 ...
-
bioRxiv - Cell Biology 2024Quote: ... pEGFP(C1)-PP1alpha (Addgene plasmid # 44224 ...
-
bioRxiv - Cell Biology 2024Quote: ... XLone-GFP was a gift from Xiaojun Lian (Addgene plasmid # 96930 ...
-
bioRxiv - Cell Biology 2024Quote: ... AICSDP-42:AAVS1-mTagRFPT-CAAX was a gift from Allen Institute for Cell Science (Addgene plasmid # 107580; http://n2t.net/addgene:107580; RRID:Addgene_107580). APEX2-NLS ...
-
bioRxiv - Cell Biology 2024Quote: ... and pEYFP(C1)-PP1gamma (Addgene plasmid # 44230 ...
-
bioRxiv - Cell Biology 2024Quote: ... pEGFP(N3)-PP1beta (Addgene plasmid # 44223 ...
-
bioRxiv - Cell Biology 2024Quote: ... pECFP(C1)-NIPP1 (Addgene plasmid # 44226 ...
-
bioRxiv - Cell Biology 2024Quote: ... pEGFP(N3)-PP1beta (Addgene plasmid # 44223; http://n2t.net/addgene:44223; RRID:Addgene_44223), and pEYFP(C1)-PP1gamma (Addgene plasmid # 44230 ...
-
bioRxiv - Cell Biology 2024Quote: ... XLone-GFP was a gift from Xiaojun Lian (Addgene plasmid # 96930; http://n2t.net/addgene:96930; RRID:Addgene_96930) (Randolph et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... William Sellers (Addgene plasmids #9005 and #9006 respectively) and previously described 47 ...
-
bioRxiv - Neuroscience 2024Quote: ... The chimeric Gqi9 protein was ordered from Addgene (Plasmid No. 125711). This was then further modified using PCR and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Neuroscience 2024Quote: ... and 20% Cre-dependent GCaMP6f (AAV.CAG.Flex.GCaMP6f.WPRE.SV4089; Addgene, #100835). For SK2-KO mice ...
-
bioRxiv - Neuroscience 2024Quote: ... QF2 was amplified from Gbait-hsp70-QF2-pA (Addgene plasmid #122563 ...
-
bioRxiv - Neuroscience 2024Quote: ... pT3TS-nCas9n template DNA (Addgene, plasmid #46757; Jao et al., 2013) was digested with XbaI (R0145S ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting DNA was cloned into the pDR274 vector (Addgene, plasmid #42250; Hwang et al., 2013) following digestion of pDR274 with BsaI (R3733S ...
-
bioRxiv - Genetics 2024Quote: ... The fragment was subcloned into pPD49.83 (a gift from Andrew Fire, Addgene plasmid # 1448 ...
-
bioRxiv - Genetics 2024Quote: ... pHT101 (a gift from Casonya Johnson, Addgene plasmid # 61021; http://n2t.net/addgene:61021; RRID: Addgene_61021) using Pst1 and Age1 restriction sites ...
-
bioRxiv - Genetics 2024Quote: ... pHT101 (a gift from Casonya Johnson, Addgene plasmid # 61021 ...
-
bioRxiv - Genetics 2024Quote: ... The fragment was subcloned into pPD49.83 (a gift from Andrew Fire, Addgene plasmid # 1448; http://n2t.net/addgene:1448 ; RRID:Addgene_1448) using BamH1 and Nco1 restriction sites ...
-
The haplolethal gene wupA of Drosophila exhibits potential as a target for an X-poisoning gene drivebioRxiv - Genetics 2024Quote: The design protocol of Port and Bullock (2016) was used to clone gRNA sequences into the pCFD5_w plasmid (Addgene #112645). Three separate plasmids were generated that targeted haplolethal genes on the X chromosome ...
-
bioRxiv - Developmental Biology 2024Quote: ... which was then cloned into pENTR-dTOPO (Thermo) for Gateway cloning into PB-TA-ERN (Knut Woltjen, Addgene #80474, (Kim et al., 2016)) to generate PB-TA-ERN-hTFAP2A(CR)-HA ...
-
bioRxiv - Developmental Biology 2024Quote: ... The TFAP2A gRNA targeted site of human TFAP2A construct (gift of Robert Tjian, Addgene #12100, (Williams and Tjian, 1991)) was mutated using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and REV (RRID:Addgene_22036) using Lipofectamine 3000 reagent (Invitrogen™ ...
-
bioRxiv - Cancer Biology 2024Quote: ... 293T cells were co-transfected with lentiCRISPR v2 construct and the second-generation lentiviral packaging plasmids pMD2.G for VSV-G (RRID:Addgene_12259) and pCMVR8.74 for GAG ...
-
bioRxiv - Developmental Biology 2024Quote: ... sgRNA oligos targeting the C-terminal region of target genes were cloned into the pX330 Cas9/sgRNA expression plasmid (Addgene 42230). For generation of the reporter line ...
-
The haplolethal gene wupA of Drosophila exhibits potential as a target for an X-poisoning gene drivebioRxiv - Genetics 2024Quote: ... attP40{nos-Cas9}/CyO which carries a recessive lethal allele on the second chromosome and cannot be made homozygous) or (ii) a line we generated that has nos-Cas9 (from Addgene plasmid 62208 courtesy of Simon Bullock which has a single NLS and a 3’UTR from nanos ...
-
bioRxiv - Cell Biology 2024Quote: ... AICSDP-82:SON-mEGFP was a gift from Allen Institute for Cell Science (Addgene plasmid # 133964 ...
-
bioRxiv - Cell Biology 2024Quote: ... pECFP(C1)-NIPP1 (Addgene plasmid # 44226; http://n2t.net/addgene:44226; RRID:Addgene_44226), pEGFP(C1)-PP1alpha (Addgene plasmid # 44224 ...
-
bioRxiv - Cell Biology 2024Quote: ... APEX2-NLS was a gift from Alice Ting (Addgene plasmid # 124617 ...
-
bioRxiv - Neuroscience 2024Quote: pEGFP-Q23 and pEGFP-Q74 plasmids were a gift from David Rubinsztein (Addgene plasmid # 40261 and 40262) [44] ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligos were designed and cloned into the CRISPRi-v2 sgRNA plasmid pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene plasmid #60955) using sequences from (Horlbeck et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... in 200 uL of OptiMEM with 0.8 ug of the I-SceI expression plasmid (pCBASce, Addgene #60960). The media was replaced the next morning and the cells were trypsinized 48-hours post-transfection for analysis of GFP expression by flow cytometry (BD Biosciences).
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with lentivirus generated from the PIP-FUCCI plasmid (Addgene plasmid #138715) as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 10 sgRNAs per gene (hCRISPRi-v2; both the “top5” and “supp5” libraries from Addgene #1000000090) were prepared as described in (Palmer et al. ...
-
bioRxiv - Synthetic Biology 2024Quote: All mammalian plasmids expressing Cas9 and deadCas9-fused transcriptional activators were acquired from Addgene: dCas9-Vp64 (#47107) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The fragments were inserted into an XhoI and PsyI linearized plasmid (Addgene #112685) harboring the Cas9-T2A-eGFP expression cassette and an Opie2-DsRed marker ...
-
bioRxiv - Plant Biology 2024Quote: ... plasmids were obtained from Addgene or were kindly provided by Dr ...
-
bioRxiv - Microbiology 2024Quote: ... Bru-GFP ΔENV was generated as previously described (63) with pmD2.G (Addgene).
-
bioRxiv - Microbiology 2024Quote: ... pHelper and pAAV-2.5 capsid plasmids were used (Addgene and (16). For VLP production ...
-
bioRxiv - Microbiology 2024Quote: ... psPAX2 and pmD2.G were used (Addgene). For HIV-1 ΔENV production ...
-
bioRxiv - Genomics 2024Quote: ... we nucleofected five million cells with five µg of spCas9/sgRNA-expression plasmids (pX330-U6-Chimeric-BB-CBh-hSpCas9, Addgene #42230) by Nucleofector 2b ...