Labshake search
Citations for Addgene :
1401 - 1450 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... (GTGCTTCTCCGGTCCAGGCT) for Grip84 and Grip163 respectively were cloned into pCFD5 vector (Addgene, 112645) at Bbs1 restriction site using HiFi DNA Assembly Master Mix (E2621S ...
-
bioRxiv - Cell Biology 2024Quote: ... TetO-NGN2-eGFP-Puro plasmid (Addgene, #79823) using Polyethyleneimine (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... RSV (Addgene, #12253), pMDL (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... Complementary gRNAs were annealed and subcloned into the pSpCas9(BB)-2A-GFP (pX-458) vector (#48138; Addgene) between BbsI endonuclease restriction sites ...
-
bioRxiv - Cell Biology 2024Quote: ... which was a gift from Kevin Janes (Addgene plasmid #136536; http://n2t.net/addgene:136536; RRID:Addgene_136536). Constructs were validated with Sanger sequencing before use ...
-
bioRxiv - Cell Biology 2024Quote: ... which was a gift from Kevin Janes (Addgene plasmid #136536 ...
-
bioRxiv - Cell Biology 2024Quote: ... The pmGFP-P2A-K0-P2A-RFP (Addgene #105686) and pmGFP-P2A-K20-P2A-RFP (Addgene #105688 ...
-
bioRxiv - Cell Biology 2024Quote: ... a LAMP1-mRFP plasmid (Addgene, 34611) was linearized using NdeI ...
-
bioRxiv - Cell Biology 2024Quote: ... Both Flox and iKO cells were transfected with 600ng of tfLC3 plasmid (Addgene, 21704) using Lipofectamine LTX (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 μg sgRNA plasmid (BPK1520, Addgene #65777), 7.5 μg pCMV_AncBE4max_P2A_GFP plasmid (for base-editing ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragment of tight TRE promoter with ATG start codon and 3XFLAG tag was amplified from pCW-Cas9 (Addgene #50661). The DNA fragment of hPGK-PuroR-rTetR was amplified from pCW-Cas9 ...
-
bioRxiv - Cell Biology 2024Quote: ... or pCAS9- mCherry-Frame +1 plasmid (for conventional CRISPR-Cas9, Addgene #66940), together with 10 μg PiggyBac transposon system (5 μg transposase + 5 μg hygromycin resistance containing transposon)8 were co-electroporated into human duodenum ...
-
bioRxiv - Cell Biology 2024Quote: ... 7.5 μg pCMV_AncBE4max_P2A_GFP plasmid (for base-editing, Addgene #112100) or pCAS9- mCherry-Frame +1 plasmid (for conventional CRISPR-Cas9 ...
-
bioRxiv - Cell Biology 2024Quote: ... spacer sequences for sgRNAs were cloned as previously described in the empty sgRNA backbone that was a kind gift from Keith Joung (BPK1520, Addgene #65777)7 ...
-
bioRxiv - Cell Biology 2024Quote: ... E2Crimson Mtb was generated by transformation with pTEC19 (Addgene 30178 ...
-
bioRxiv - Cell Biology 2024Quote: ... B16-F1 cells were transiently transfected with LifeAct-TagRed and PA-GFP-Actin (Addgene #57121) as described above ...
-
bioRxiv - Cell Biology 2024Quote: B16-F1 cells were transiently transfected with pEGFP-Paxillin (Addgene plasmid #15233) as described above and plated onto 35 mm glass-bottom Ibidi dishes coated with laminin ...
-
bioRxiv - Cell Biology 2024Quote: pGFP-EB1 (Addgene plasmid #17234) was transiently transfected into the B16-F1 control and Cyri-b KO cells and imaged live on a Zeiss 880 microscope with Airyscan with a Plan-Apochromat 63x/1.4 oil DIC objective lens with the 488nm laser at 1 image per second for 120 seconds ...
-
bioRxiv - Cell Biology 2024Quote: B16-F1 cells were transiently transfected with CYRI-B-p17-GFP and mCherry-β1 integrin (Addgene plasmid #55064) and plated on laminin coated glass bottom dishes ...
-
bioRxiv - Cell Biology 2024Quote: ... subsequently Dm-KHC(1-421)-SNAP-6xHis (gift from Kapitein lab, Addgene plasmid #196976) labelled with Alexa647-SNAP dye (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... envelope plasmid (Addgene plasmids were a gift of D ...
-
bioRxiv - Cell Biology 2024Quote: ... and pMD2.VSVG (Addgene, #12259) envelope plasmid (Addgene plasmids were a gift of D ...
-
bioRxiv - Cell Biology 2024Quote: ... the lentiviral psPAX packaging (Addgene, #12260) and pMD2.VSVG (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... pmGFP-Sec16L was a gift from Benjamin Glick (Addgene plasmid # 15776 ...
-
bioRxiv - Cell Biology 2024Quote: Lentiviral-TOP/FOP-dGFP-reporters (wild-type consensus plasmid TOP: Addgene plasmid #14715 ...
-
bioRxiv - Cell Biology 2024Quote: Lentiviral-TOP/FOP-dGFP-reporters (wild-type consensus plasmid TOP: Addgene plasmid #14715; http://n2t.net/addgene:14715; RRID:Addgene_14715 ...
-
bioRxiv - Cell Biology 2024Quote: ... Str-KDEL_SBP-EGFP-Ecadherin was a gift from Franck Perez (Addgene plasmid # 65286 ...
-
bioRxiv - Cell Biology 2024Quote: Lentiviral-TOP/FOP-dGFP-reporters (wild-type consensus plasmid TOP: Addgene plasmid #14715; http://n2t.net/addgene:14715; RRID:Addgene_14715; inverted consensus plasmid FOP: Addgene plasmid # 14885 ...
-
bioRxiv - Cell Biology 2024Quote: ... Str-KDEL_SBP-EGFP-Ecadherin was a gift from Franck Perez (Addgene plasmid # 65286; http://n2t.net/addgene:65286; RRID:Addgene_65286).
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... the sgRNA spacers were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene #62988) as described previously (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... HYLS1 crRNA was cloned into the Lenti-CRISPR-V2 backbone (a gift from Feng Zhang; Addgene plasmid #52961) and transfected with the pCMV-VSV-G (a gift from Bob Weinberg ...
-
bioRxiv - Cell Biology 2024Quote: ... which was a gift from Kevin Janes (Addgene plasmid #136536 ...
-
bioRxiv - Cell Biology 2024Quote: ... which was a gift from Kevin Janes (Addgene plasmid #136536; http://n2t.net/addgene:136536; RRID:Addgene_136536), pCMV dR8.2 dvpr (Addgene 8455 ...
-
bioRxiv - Cell Biology 2024Quote: ... plk1 T210A was a gift from Michael Yaffe (Addgene plasmid # 132965 ...
-
bioRxiv - Cell Biology 2024Quote: ... plk1 T210A was a gift from Michael Yaffe (Addgene plasmid # 132965; http://n2t.net/addgene:132965; RRID:Addgene_132965). plk1 WT GFP-myc was a gift from Michael Yaffe (Addgene plasmid # 132963 ...
-
bioRxiv - Cell Biology 2024Quote: ... plk1 WT GFP-myc was a gift from Michael Yaffe (Addgene plasmid # 132963 ...
-
bioRxiv - Cell Biology 2024Quote: ... psPAX2 and pMD2G were obtained from Addgene. A C-terminal 19 aa truncated SARS-CoV-2 spike expression vector and CMV-eGF1 were kind gifts from Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... and pCMV-VSV-G (Addgene 8454, gift from Bob Weinberg) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... pCMV dR8.2 dvpr (Addgene 8455, gift from Bob Weinberg), and pCMV-VSV-G (Addgene 8454 ...
-
bioRxiv - Cell Biology 2024Quote: ... plk1 WT GFP-myc was a gift from Michael Yaffe (Addgene plasmid # 132963; http://n2t.net/addgene:132963; RRID:Addgene_132963).
-
bioRxiv - Cell Biology 2024Quote: ... a pME-Lifeact (65) plasmid was a gift from Rob Parton (Addgene plasmid #109545). Using gateway cloning ...
-
bioRxiv - Cell Biology 2024Quote: The vector pJB166 (Addgene #86998) expressing SpCas9 under the adh1 promoter ...
-
bioRxiv - Cell Biology 2024Quote: ... either pMX-puro-MGT (Addgene, #111809), a polycistronic vector that expresses the reprogramming factors Mef2c ...
-
bioRxiv - Cell Biology 2024Quote: ... Gata4 and Tbx5 (MGT) or pBabe-puro (an emptyback bone vector, used as mock/control; Addgene, #1784) were mixed with 4 μg pCL-Ampho (retroviral packaging plasmid) ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cell Biology 2024Quote: ... Iino (Addgene plasmid # 58216). The plasmid encoding TMEM192-GCAMP7 was constructed by cloning TMEM192 and GCAMP7 sequence into pcDNA 3.1/Zeo (+ ...
-
bioRxiv - Cell Biology 2024Quote: The CRY2olig-mCherry backbone vector was a gift from Chandra Tucker (Addgene plasmid # 60032) (Taslimi et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... pEX-CMV-SP-YFP-STIM2(15-746) EF hand D80A was a gift from Tobias Meyer (Addgene plasmid # 18864 ...
-
bioRxiv - Cell Biology 2024Quote: ... pEX-CMV-SP-YFP-STIM2(15-746) EF hand D80A was a gift from Tobias Meyer (Addgene plasmid # 18864; http://n2t.net/addgene:18864; RRID:Addgene_18864). N-glycosidase F (PNGaseF ...