Labshake search
Citations for Takara Bio :
3701 - 3750 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... a Living Colors® EGFP mouse monoclonal antibody (632569, Clontech), or a mouse monoclonal anti-actin antibody (clone AC-40 ...
-
bioRxiv - Genomics 2023Quote: ... a vector containing homology arms was generated by PCR-amplification of HAP1 gDNA and cloning of products into a linearized pUC19 backbone (InFusion, Takara Bioscience). Primers for these PCRs were designed such that homology arms would be between 200 bp and 1300 bp ...
-
bioRxiv - Immunology 2023Quote: ... followed by RNA reverse transcription by SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech). After enzymatic fragmentation of cDNA samples by KAPA Frag kit (KAPA Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... supernatants were harvested and concentrated with Lenti-X™ Concentrator (Takara# 631232). Virus pellet was resuspended in 1∼4 mL RPMI1640 medium (with 10% FBS) ...
-
bioRxiv - Immunology 2023Quote: ... The 6-His tagged recombinant proteins were purified from the supernatant by gravity-fed through TALON® Metal Affinity Resin (Takara Bio, Shiga, Japan). Following a wash step with PBS (pH 8) ...
-
bioRxiv - Immunology 2023Quote: ... Probes (50 ng) were labeled with 32P using the Ladderman DNA labeling kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... RNA-seq analysis was supported by Takara Bio Inc ...
-
bioRxiv - Immunology 2023Quote: ... Genomic DNA samples from the patients’s paired tumor tissues and WBCs were used to prepare DNA libraries for DNA sequencing with the ThruPLEX Tag-seq Kit (Takara Bio, USA). The libraries were then pooled and hybridized with pre-designed probes for 95 targeted genes (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2023Quote: ... and Ofatumumab-LC were generated in the pVAX backbone by Infusion cloning (Takara) of synthesized gBlocks (IDT) ...
-
bioRxiv - Immunology 2023Quote: ... Lenti-X 293T cells (Takara Bio USA) were cultured at 37°C with 5% CO2 in DMEM with 10% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... 1x ROX reference dye (Takara), 300 nM of each forward and reverse primer (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... Real time PCR was carried out in 20 µl reaction mixtures containing 1x TB Green Premix Ex Taq (Takara), 1x ROX reference dye (Takara) ...
-
bioRxiv - Microbiology 2023Quote: ... concentrated 10x using the Lenti-X lentivirus concentrator (Clontech Laboratories, Inc. Mountainview, CA), resuspended in dPBS+/+ ...
-
bioRxiv - Microbiology 2023Quote: ... living colors antibody was purchase from Clontech (Cat# 632381). The Alexa Fluor 568 goat anti-mouse IgG H+L antibody was purchased from ThermoFisher (Cat# A11004) ...
-
bioRxiv - Microbiology 2023Quote: ... using Ex Taq polymerase (Takara Bio, Tokyo, Japan) with the following cycling conditions ...
-
bioRxiv - Immunology 2023Quote: ... 0.1mM EDTA) supplemented with 0.2U/µl recombinant RNase Inhibitor (Takara, Catalog # 2313B). Nuclei were counted and kept on ice (or for longer storage at - 80°C) ...
-
bioRxiv - Immunology 2023Quote: ... 0.6% NP-40 and freshly added 1mM DTT) supplemented with 0.2U/µl recombinant RNase Inhibitor (Takara, Catalog # 2313B) and incubated for 5 minutes on ice ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DSred primary antibody 1:500 (Takara, 632496) which binds Td-tomato protein ...
-
bioRxiv - Neuroscience 2023Quote: ... We obtained 20 ng/ul RNAs (total 10 ul eluted RNA from one microdissected cell body) that we used for RNAseq (Clontech SMART-Seq Ultra Low Input RNA kit) in Scripps Florida Genomics Core (Currently known as The Herbert Wertheim UF Scripps Institute for Biomedical Innovation & Technology) ...
-
bioRxiv - Neuroscience 2023Quote: ... Cold Lenti-X Concentrator (Takara; Cat. No. 631232) corresponding to one-third volume of the supernatant was added to the filtered solution ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was obtained by reverse transcription using the PrimeScript RT Reagent Kit (Takara, Kusatsu, Japan). RT-qPCR was performed with the respective human-specific sense and antisense primers and RT-SYBR™ Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... transfected iPSCs were selected for 48 hours with 0.5 μg/mL puromycin (Takara). Differentiation of iPSCs into iNeurons was performed using an established protocol35 ...
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
Tight junction membrane proteins regulate the mechanical resistance of the apical junctional complexbioRxiv - Cell Biology 2023Quote: ... using an In-Fusion HD Cloning Kit (Takara; #Z9649N). pCANw-HA-cZO1-Flag was created by inserting an HA tag into the N-terminus of cZO-1 by PCR using the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... or TB Green Premix Ex Taq II (Tli RnaseH Plus) Kit (Takara), 1μM primers and 1μL of cDNA ...
-
bioRxiv - Neuroscience 2023Quote: ... or the PrimeScript RT Master Mix (Takara). In each individual experiment ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: AAV transfer plasmids were constructed by removing all the sequences between the ITRs of the pAAV-CMV vector (TaKaRa) and inserting the Mhck7 promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... The helper plasmid used was pHelper (TaKaRa).
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated using NucleoZOL (Takara, Shiga, Japan, Cat. No. 740404.200) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: The in-fusion reaction using the HD in-fusion kit (Takara Bio) was carried out using 100ng of the cut vector ...
-
bioRxiv - Microbiology 2023Quote: ... Fragments were joined via crossover PCR using PrimeStar Max (Takara Bio) per manufacturer instruction ...
-
bioRxiv - Immunology 2023Quote: Lenti-X 293T (human embryonic kidney) cells were purchased from Takara Bio Inc ...
-
bioRxiv - Immunology 2023Quote: ... The viral particles in the supernatant were then concentrated using the LentiX Concentrator (Takara Bio), in accordance with the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: ... cDNA was synthesized using PrimeScript Reverse Transcriptase (TakaRa) and amplified using home-made PCR master mix ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentivirus titer was estimated using a p24 Rapid Titer Kit (Takara Bio USA, Inc). Mice were anesthetized by isoflurane inhalation ...
-
bioRxiv - Cell Biology 2023Quote: ... using In-Fusion Cloning kit (Takara).
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a modified pCaSpeR4 vector containing the αTub84B promoter (Marois et al., 2006) using In-Fusion cloning kit (Takara Bio, Japan). Forward primer sequence was 5’-CTAGAGGATCCCCGGGTACCATGGTGAGCAAGGGCGAG-3’ and reverse primer sequence was 5’-TCGAGGGGGGGCCCGGTACCTTAATTGTAAGTAATACTAGATCCAGGGTATAAAGTT GTTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were pre-treated 1 hour prior to the assay with A/C Heterodimerizer (Takara) diluted at 1:200 in complete media concurrent with JF-Halo or -SNAP dye labeling ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (Clontech #632496, 1:200), rat anti-HA (Roche 3F10 ...
-
bioRxiv - Biophysics 2023Quote: Plasmids used in this study (Supplementary Table S1) were assembled by Polymerase Chain Reactions (PCR) amplifying insert and vector DNA fragments followed by In-Fusion cloning (Takara Biosciences, In-Fusion HD Cloning Kit). Oligonucleotides (Integrated DNA Technologies ...
-
bioRxiv - Developmental Biology 2023Quote: ... or NucleoSpin RNA Plus XS (Takara Bio) kit ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-Rab5A (pJV0054) was generated similarly: cDNA was cloned via PCR using primeSTAR max DNA polymerase (Clontech). This was followed by subcloning into a zero blunt TOPO II vector (Life Technologies) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Purified total RNA was reverse transcribed into cDNA by PrimeScript II 1st strand cDNA Synthesis Kit (Takara, 6210A) or SMARTer™ RACE cDNA Amplification Kit (Clontech) ...
-
bioRxiv - Neuroscience 2023Quote: ... then cDNA was synthesized using the SMART-Seq® v4 Ultra® Low Input RNA kit (Takara Bio USA Inc. Cat No. 634888). Libraries were prepared using the NexteraTM DNA Flex Library Prep (Illumina Cat No ...
-
bioRxiv - Biochemistry 2023Quote: ... 2019) and ACOT8 (ACOT8 H78A) (Ishizuka et al., 2004) were constructed by PCR-mediated mutagenesis using PrimerSTAR DNA polymerase (Takara). cDNAs for proteins expression were constructed in pLV cs2.0 vectors ...
-
bioRxiv - Biophysics 2023Quote: ... or the InFusion cloning kit (Takara Bio) and the corresponding primer sets (Table S1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... TetON regulated transgenes were activated by 2μg/ml doxycycline (Clontech #631311) administration ...
-
bioRxiv - Cell Biology 2023Quote: ... The upstream and downstream regions adjacent to the binding site were amplified using Advantage 2 polymerase (Takara Bio, Shiga, Japan) from 3T3-L1 genomic DNA and cloned into the HR110-PA-1 vector (System Biosciences) ...