Labshake search
Citations for Takara Bio :
3351 - 3400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... pGBKT7 (Takara). Osr40C1 ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant constructs were introduced into Y1H gold strain and Y1H assay was performed using Matchmaker® Gold Yeast One-hybrid screening system (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... the 1707 bp upstream sequence from the +1 site of the OsEG45 gene was cloned into the KpnI and SacI RE sites of the pAbAi vector (Takara). The OsGF14e gene was cloned into the pGADT7-Rec vector (Takara) ...
-
bioRxiv - Plant Biology 2023Quote: ... The cDNA library was prepared from rice flowers and ligated to the pGADT7-Rec vector using the Make Your Own “Mate and Plate” Library System (Takara). A second cDNA library was prepared from rice leaves under salt stress ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant plasmids were co-transformed into yeast Y2H Gold strain (Takara). The transformed yeast strains were grown on DDO (SD/-Leu/-Trp ...
-
bioRxiv - Immunology 2023Quote: ... RNA isolation and cDNA amplification was performed using either Smart-Seq® v4 Ultra® Low Input RNA Kit (Takara Clontech, cat# 635015) or NORGEN BIOTEK (cat# 51800) ...
-
bioRxiv - Immunology 2023Quote: ... RNA isolation and cDNA amplification was performed using either Smart-Seq® v4 Ultra® Low Input RNA Kit (Takara Clontech, cat# 635015) or NORGEN BIOTEK (cat# 51800) ...
-
bioRxiv - Bioengineering 2023Quote: ... 5.0 (TaKaRa). High-fidelity KOD-Plus-Neo DNA polymerase was used to amplify the sequences containing the degenerate codons ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids coding EGFP-mutants were generated from EGFP-IRES-mCherry plasmid using TaKaRa MutanBEST Kit (TaKaRa, Kusatsu, Japan). pG5egfp reporter vector was modified from the pG5luc vector (GeneBank Accession Number AF264724 ...
-
bioRxiv - Neuroscience 2023Quote: ... were transiently cotransfected with a 2:1 mixture of Nav1.7-expressing plasmid8 and a pIRES2-ZsGreen bicistronic plasmid (Takara Bio, San Jose, CA) expressing ZsGreen and mouse FHF2B proteins.10 The same pIRES2-ZsGreen plasmid without FHF2 coding sequence served as the control ...
-
bioRxiv - Molecular Biology 2023Quote: ... and reverse transcribed into cDNA using a PrimeScript RT Master Mix (Takara RR036A, Kusatsu, Shiga, Japan). Quantitative real-time RT-PCR analysis was performed using TB Green Premix Ex Taq (Clontech ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the cDNA was synthetised using the PrimeScript RT Master Mix Kit (TaKaRa, RR036A). The qPCR was performed using PerfectStartTM Green qPCR Super Mix (TransGen Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... Then the cDNA was synthesized using PrimeScript RT Reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa). Real-time quantitative PCR was performed as previously described [13 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Neurons were transfected with GCaMP6 or NEMO-encoding plasmids at 7 to 9 days after plating using a calcium phosphate transfection kit (Takara Bio Inc).
-
bioRxiv - Systems Biology 2023Quote: ... sSH2 domains were immediately purified by the N-terminal His6 tag with TALON® resin (Takara Bio) using a gravity column (detailed purification method in the Supporting Methods 1) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Stellar competent Escherichia coli cells (Takara Bio) were routinely grown in LB supplemented with kanamycin (Kan ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cloning was completed using InFusion (Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was prepared using In-Fusion Cloning system (Clontech, Mountain View, CA, USA). Two DNA fragments were independently amplified with two primer sets (NLS_Fw1/Rv1 ...
-
bioRxiv - Synthetic Biology 2023Quote: Amplicons were prepared for sequencing using Takara ThruPLEX® DNA-Seq Kit (Takara Bio, cat #R400674), which included unique dual indexing ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 ng of isolated RNA was then used as input for generating cDNA and cDNA synthesis was performed using the PrimeScript RT kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Neuroscience 2023Quote: The pIRES2-EGFP vector (Cat. #V11106; Clontech) was modified by enzymatic restriction to insert the Dlx5/6 promoter (Gift from G ...
-
bioRxiv - Microbiology 2023Quote: ... each RT reaction solution was amplified in 25 µl of SYBR Premix Ex Taq II (Takara Bio, Inc.) containing 0.2 µM of each primer ...
-
bioRxiv - Microbiology 2023Quote: ... Dye Plus (Takara), and primers (46 ...
-
bioRxiv - Microbiology 2023Quote: ... All cloning experiments were performed using an In-Fusion HD Cloning Kit (Takara Bio Inc., Shiga, Japan), and plasmid sequences were confirmed using a DNA sequencing service (Core Instrumentation Facility ...
-
LptM promotes oxidative maturation of the lipopolysaccharide translocon by substrate binding mimicrybioRxiv - Microbiology 2023Quote: ... membranes were incubated with epitope-specific rabbit polyclonal antisera or with an anti poly-histidine horseradish peroxidase-conjugated monoclonal antibody (TaKaRa). Immunodetection was revealed by using a Clarity Western ECL blotting substrate (BioRad ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using the PrimeScript™ II 1st strand cDNA Synthesis Kit (Takara). PCR was performed using PrimeSTAR GXL Premix Fast ...
-
bioRxiv - Microbiology 2023Quote: ... we used Primer/Probe N2 (2019-nCoV) (TaKaRa). The reaction conditions for RT-PCR were 42 °C for 5 min and 95 °C for 10 s ...
-
bioRxiv - Molecular Biology 2023Quote: ... PrimeSTAR® Max DNA Polymerase (Takara Bio) was used for amplifying gene fragments by PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... SapphireAmp Fast PCR Master Mix (Takara Bio) was used for verifying E.coli and M ...
-
bioRxiv - Cell Biology 2023Quote: ... Aurora A and TPX2 were amplified from human testis cDNA (Marathon cDNA, Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Crx (rabbit; 1:200; Takara), anti-Recoverin (rabbit ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Rx (guinea pig; 1:2000; Takara), anti-Crx (rabbit ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibodies and dyes were used at following dilutions: rabbit-α-dsRed (1:500, Takara, #632496; RRID:AB_10013483), α-HRP conjugated with Alexa Fluor-488 (1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... Physical and functional titers were obtained using the Lenti-X qRT-PCR Titration Kit (Takara 631235) and qPCR of genomic DNA following HEK293T transduction91 ...
-
bioRxiv - Pathology 2023Quote: ... and subsequently treated with RNase-free DNase I (Takara Bio, Dalian, China) as instructed by the manufacturers ...
-
bioRxiv - Neuroscience 2023Quote: ... U2OSQ94 cells were cultured in DMEM +Glutamax supplemented with 10% Tet system approved FBS (Takara, 631368) and 1% Penicillin/Streptomycin ...
-
bioRxiv - Pathology 2023Quote: Yeast transformation was performed according to the manufacturer’s instructions (Clontech, Mountain View, CA, USA). Yeast cells (strain Y2H Gold ...
-
bioRxiv - Neuroscience 2023Quote: ... DsRed-Mito (Clontech) was purchased ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and pLL3.7m plasmids using CalPhos mammalian transfection kit (Takara Bio). Two days following transfection ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Molecular cloning was typically carried out using infusion HD cloning kit (Takara Bio) with a plasmid vector linearized by restriction enzymes and an assembled DNA insert with ~20 overlapping DNA sequences ...
-
bioRxiv - Neuroscience 2023Quote: ... plasmid libraries were made using the inverse PCR method with PrimeSTAR Max DNA polymerase (Clontech), In-Fusion HD Cloning Kit (Clontech) ...
-
bioRxiv - Neuroscience 2023Quote: ... reverse transcribed by PrimeScript RT reagent Kit (Takara) and quantified using SYBR Green Real-Time PCR Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from retinas with TRIzol Reagent (Life) and then used for reverse transcription by PrimeScript RT Master Mix (TaKaRa). Synthesized cDNA was performed with 2× ChamQ Universal SYBR qPCR Master Mix (Vazyme ...
-
bioRxiv - Neuroscience 2023Quote: ... Human cDNA for α7-nAChRs and NACHO inserts were cloned using In-fusion cloning kit (Takara). After cloning in the lentiviral transfer plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... In-Fusion HD Cloning Kit (Clontech), and primers which included NNK codons ...
-
bioRxiv - Neuroscience 2023Quote: The following previously published or commercially DNA constructs were used: pDsRed2-Mito (Clontech Laboratories Inc.), Mito-BFP 60 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were incubated with rabbit anti-DsRed (TaKaRa Bio, cat. no. 632496) at 1:1000 and guinea pig anti-Cre (Synaptic Systems ...
-
bioRxiv - Pathology 2023Quote: ... Affinity purification was performed at 4°C using Talon metal affinity resins (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...