Labshake search
Citations for Takara Bio :
1951 - 2000 of 2391 citations for PCR Tube since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: The full-length sequences of sea perch RNF34 (GenBank accession number: OP784387) was amplified by PCR using primers (S1 Table) and was subsequently cloned into pCMV-Flag/Myc vector (Clontech). RNF34 deletion mutants (RNF34ΔRING and RNF34ΔZinc ...
-
bioRxiv - Microbiology 2023Quote: ... The resultant reaction mixture was then 10-fold diluted and subjected to quantitative PCR using TB Green Premix Ex Taq II kit (TaKaRa) in combination with a tag primer (no ...
-
bioRxiv - Immunology 2022Quote: ... Sequences encoding DCFHP (residues 1-1146 of HexaPro)2 and SΔC-Fer (residues 1-1143 as previously described)3 were cloned into the pADD2 vector backbone using HiFi PCR (Takara) followed by In-Fusion (Takara ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genes were analysed by quantitative real-time PCR in triplicate with at least three independent biological replicates using SYBR premix EX Taq (Takara). Quantification was performed as indicated in the figure legends ...
-
bioRxiv - Plant Biology 2023Quote: ... were PCR-amplified and fused to a nuclear localization signal (NLS) in pENTR vectors using In-Fusion HD Cloning Plus (Clontech). See Table S5 for primer details ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative real-time RT-PCR analysis was performed using TB Green Premix Ex Taq (Clontech, RR420A, Mountain View, CA, USA). The following diluted primers were used ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA copies of IBVs were quantified by real-time PCR using TB Green Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa) and the following primer pair ...
-
bioRxiv - Bioengineering 2023Quote: ... with each 20 μl of PCR mixture containing 10 μl of TB Green Premix Ex Taq II (Tli RNase H Plus, Takara), 0.4 μl of each PCR forward and reverse primers (10 μM) ...
-
bioRxiv - Microbiology 2023Quote: ... by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pRetroX-TRE3G (TaKaRa). pBS-UGI-flag was constructed by amplifying the UGI and flag sequence from UGI- pFERp44 by PCR and cloning it into the NotI and EcoRI sites of pBluescript II KS(+ ...
-
bioRxiv - Biochemistry 2023Quote: ... into which a PCR-amplified DNA fragment containing the mNeonGreen gene (Shaner et al., 2013) was inserted using the in-Fusion reaction (Clontech). To generate pRS426-CPY(1-50)-ATG15(Δ1-35)-mNeonGreen (YPL073) ...
-
bioRxiv - Microbiology 2023Quote: ... The nine fragments of SARS-CoV-2 and the UTR linker for SARS-CoV-2 were prepared by PCR using PrimeSTAR GXL DNA polymerase (Takara). After gel purification of the fragments ...
-
bioRxiv - Biochemistry 2023Quote: ... 2019) and ACOT8 (ACOT8 H78A) (Ishizuka et al., 2004) were constructed by PCR-mediated mutagenesis using PrimerSTAR DNA polymerase (Takara). cDNAs for proteins expression were constructed in pLV cs2.0 vectors ...
-
bioRxiv - Genomics 2023Quote: A putative enhancer region encompassing approximately 550 bp on either side of each proxy SNP was identified and amplified using PCR for infusion cloning (Takara), a ligase-free method to clone any insert into any vector ...
-
bioRxiv - Immunology 2023Quote: ... GISAID ID: EPI_ISL_408667) were amplified with polymerase chain reaction (PCR) using PrimeSTAR GXL DNA polymerase (Takara Bio Inc., Shiga, Japan). The corresponding SARS-CoV-2 genomic regions ...
-
bioRxiv - Microbiology 2023Quote: PCRs were conducted over 35 cycles and were based on TaKaRa Ex Taq Hot Start polymerase chemistry (Takara Bio, USA). For 16S rRNA gene amplification ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by an SGG linker and then the ferritin protein1 were cloned into the pADD2 vector backbone using HiFi PCR (Takara) followed by In-Fusion (Takara ...
-
bioRxiv - Biophysics 2023Quote: Sublibraries of different regions of SLC22A1 were PCR amplified using primer-specific and polymerase (PrimeStar GXL DNA polymerase) (Takara Bio). A total of 11 regions were PCR amplified ...
-
bioRxiv - Cancer Biology 2023Quote: ... the agarose gel pieces were cut out and digested using NucleoSpin® Gel and PCR Clean-Up kit (Takara, 740609), according to the manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... The qRT-PCR was performed by using the TB Green Premix Ex Taq (Tli RNase H Plus; TaKaRa, Cat. #RR420A) and CFX Connect Real-Time system (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... pAAV-UGI was constructed by cloning the entire coding sequence of UGI amplified from pBS-UGI-flag by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pAAV-ZsGreen1 (TaKaRa).
-
bioRxiv - Genetics 2023Quote: ... the sequences corresponding to Flag tags were replaced by those encoding for Myc tags using the In-Fusion PCR cloning system (Takara) according to the kit’s guidelines ...
-
bioRxiv - Immunology 2023Quote: ... These three segments were ligated sequentially by overlap PCR and inserted into XhoI/NotI linearized Phr-SIN vector by In-fusion cloning (Clontech) to produce full length CD1d SCD ...
-
bioRxiv - Microbiology 2023Quote: The component concentration of each reaction mix included 10μL of 2X EmeraldAmp® GT PCR master mix (Takara Bio, Japan), 1μL (0.5μM ...
-
bioRxiv - Molecular Biology 2023Quote: ... flanking the site of alterations (HDE-like motifs) were amplified from the genomic DNA using CloneAmp HiFi PCR Premix (Clontech), A-tailed with DreamTaq DNA polymerase and ligated into pGEM-T Easy vector ...
-
bioRxiv - Developmental Biology 2023Quote: ... dsDNAs were amplified by PCR using modified primers with 5’Bioton – 5 x phosphorothioate bonds (synthesized by eurofins) and PrimeSTAR Max (Takara).
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment encoding residues 1-132 was amplified using the RPA expression plasmid as a template and CloneAmp Hi-Fi PCR master mix (Clontech, Takara) following the manufacturer’s instructions ...
-
Docking Domain Engineering in a Modular Polyketide Synthase and its Impact on Structure and FunctionbioRxiv - Biochemistry 2023Quote: The DNA encoding VemG and VemH was amplified from the genomic DNA of Streptomyces venezuelae ATCC 10712 (DSMZ) by PCR and introduced into a pET22b(+) expression vector by In-Fusion Cloning (Takara). These expression plasmids were used as a template to generate all engineered venemycin assembly line constructs of this study via In-Fusion Cloning (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: Primers designed to flank the MLR of human CDHR5 were used for PCR reactions with Human Small Intestine QUICK-Clone cDNA (Clontech) as the template ...
-
bioRxiv - Cell Biology 2023Quote: ... CMV-mCherry-SV40-PA was amplified via PCR and the OLIGO273 and OLIGO274 from p-mCherry-N1 without multiple cloning site (modified Clontech, Takara; United States ...
-
bioRxiv - Cell Biology 2023Quote: ... CMV-mCherry-SV40-PA was amplified via PCR and the OLIGO273 and OLIGO274 from p-mCherry-N1 without multiple cloning site (modified Clontech, Takara ...
-
bioRxiv - Genetics 2023Quote: ... The whole fkbA locus from the FK506 resistant isolates was amplified using primers JOHE52223 and JOHE52224 and LA Taq DNA polymerase for long-range PCR with GC Buffer I (Takara). PCR conditions were optimized for long fragments as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA amplification was performed by adding 15 μL of Seq amp PCR mixture (12.5 μL of 2x SeqAmp buffer (Takara Bio), 0.05 μL of 100 μM N-IS PCR primer ...
-
bioRxiv - Pathology 2023Quote: ... Expression levels of the genes were validated by quantitative real-time PCR analysis with SYBR Green (Takara Bio, CA, USA). Cycling parameters were 95°C for 20 seconds ...
-
bioRxiv - Plant Biology 2023Quote: ... The bisulfite-converted library was split between two 50 ul reactions and PCR amplified using the following conditions: 2.5 U of ExTaq DNA polymerase (Takara Bio), 5 μl of 10X Extaq reaction buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... as per manufacturer’s protocol.The expression profile of target gene was evaluated using specific primers by using SYBR green RT-PCR master mix (Takara) in BioRad Real time PCR instrument ...
-
bioRxiv - Plant Biology 2023Quote: ... A genomic fragment containing the promotor region and full-length coding region of ATPC1 (At4g04640) was amplified from Col-0 genomic DNA by PCR using PrimeSTAR DNA polymerase (TaKaRa) and the primers ATPC1_F (CACCCATGGAGAGGGCTCGTACCTTAC ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA encoding ZP3 was restored from the mouse ovarian tissue by RT-PCR using PrimeScript RT Reagent Kit (Takara, RR037). Two PCR amplicons including the 5′ region of the TECTA-ZP and the transmembrane domain (TMD ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and IV from M13cp following PCR amplification and ligation using the In-Fusion Snap Assembly Master Mix (Takara Bio, 638944). The resulting helper plasmids were transformed into DH5α competent cells (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... The qPCR reactions were carried out and the signals were detected using a real time PCR system (catalog no. TP950, TaKaRa). For RT-qPCR ...
-
bioRxiv - Plant Biology 2024Quote: ... coli and verified the expression cassette by sequencing and repeated again this yeast two hybrid assay by using the verified plasmid DNA instead of the corresponding PCR fragment inserts and linear vectors for mbSUS interaction tests as described “mbSUS tests protocol” (Clontech).
-
bioRxiv - Molecular Biology 2024Quote: ... qRT–PCR was performed using SYBR Premix Ex TaqII (Tli RNaseH Plus) and the Thermal Cycler Dice Real Time System (TaKaRa). The data were normalized using 18S rRNA as a reference ...
-
bioRxiv - Microbiology 2023Quote: ... Genes or gene fragments were PCR amplified with primers (S2 Table) to allow for In-Fusion gene cloning (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Reverse transcription was performed using the oligo (dT) primer and AMV reverse transcriptase contained in the TaKaRa RNA PCR kit (TaKaRa). The RT-PCR was performed using KOD One PCR Master Mix (TOYOBO ...
-
bioRxiv - Plant Biology 2023Quote: ... reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) was employed using the SYBR Green PCR Master Mix (Takara, Dalian, China) in a 48-well plate and analysed using a StepOne Real-Time PCR system (PE Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... generated cDNA was subjected to real-time PCR analysis using SYBR® Premix Ex Taq™ II kit (TAKARA BIO) with the sets of specific primers (Table 1) ...
-
bioRxiv - Microbiology 2023Quote: High-throughput qPCR was performed by an outside firm (Resistomap, Finland) using the qPCR SmartChip Real-Time PCR cycler (Takara). The qPCR cycling conditions and initial data processing were carried out as previously described by Wang et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... The number of virus copies/ml was determined using the Lenti-X™ qRT-PCR Titration Kit (Takara Bioscience, 631235) according to the manual ...
-
bioRxiv - Biochemistry 2023Quote: The gene encoding XccOpgD (GenBank: AAM43366.1) was amplified by PCR with the primer pair shown in Supplementary Table 1 using PrimeSTAR Max (Takara Bio) and a genomic DNA of X ...
-
bioRxiv - Biochemistry 2023Quote: ... LAT1 mutants with amino acid substitutions or an N-terminal truncation (Δ1-50) were constructed by whole-plasmid PCR using PrimeSTAR MAX DNA polymerase (Takara). The corresponding codons were altered as follows for amino acid substitution ...
-
bioRxiv - Biochemistry 2023Quote: ... The PCR product was inserted into a BamHI and XhoI double-digested pGEX-6P-1 vector using InFusion Snap Assembly (Takara), resulting in the expression construct for GST-3C-GCP21-110 (referred to as “GST-GCP2-NHD”) ...