Labshake search
Citations for Takara Bio :
1401 - 1450 of 2391 citations for PCR Tube since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Then cDNA was synthesized according to the protocol of the RT-PCR kit (Takara; Kusatsu, Shiga, Japan) and used as templates for quantitative PCR ...
-
bioRxiv - Genetics 2021Quote: ... and One Step TB Green™ PrimeScript™ RT-PCR Kit II (SYBR Green) (TaKaRa RR086B, Japan).
-
bioRxiv - Cell Biology 2021Quote: ... DNA was amplified from WT genomic DNA by PCR using Advantage 2 Polymerase (#639202, Takara Bio, USA). Plasmid backbones were double-digested with the necessary restriction enzymes and purified using the Qiagen DNA purification kit (#28704X4 ...
-
bioRxiv - Genomics 2020Quote: ... PCR reactions were carried out according to manufacturer’s instructions using either ExTaq polymerase (TaKaRa Bio, Tokyo, Japan) or PCR master mix (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... RNA-free cDNA (5μL) was used as a template for PCR with PrimeStar GXL Polymerase (Takara, Japan) and back-to-back PCR primers (LigSeq-F and LigSeq-R ...
-
bioRxiv - Neuroscience 2020Quote: ... The lentiviral genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara).
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed by TB Green® Premix Ex Taq™ □ (Tli RNaseH Plus) (TAKARA, Japan) on the CFX96 Touch™ Real-Time PCR Detection System (BIO-RAD ...
-
bioRxiv - Cell Biology 2021Quote: ... Slc37a2 was amplified by PCR from BMMCs cDNA and inserted into a plEGFP-C1 plasmid (Takara Bio). Slc37a2 plEGFP-C1 plasmid or plasmid vector control were transfected into Amphopack-293 cells (BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... Q-PCR was carried out using the SYRB Premix Ex Taq™ Perfect Real-Time system (Takara). The expression levels were normalized to that of the housekeeping gene GADPH ...
-
bioRxiv - Microbiology 2020Quote: ... The synthetic sequence was cloned into inversely amplified pSW002-Pc PCR product by infusion cloning (Takara, Z9633N). pSW002-Pc was a gift from Rosemarie Wilton (Addgene plasmid # 108234 ...
-
bioRxiv - Plant Biology 2020Quote: ... Gene specific primers were used to amplify cDNA by PCR using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4-minute denaturation at 95°C followed by 30 to 40 cycles of 30 seconds at 95°C ...
-
bioRxiv - Microbiology 2020Quote: ... the genomic DNA served as a template for PCR with Tks Gflex DNA polymerase (Takara Bio Inc.) using the following primer sets ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR amplification steps were carried out with the PrimeSTAR HS DNA Polymerase (Takara, Otsu, Shigu, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... qPCR or qRT-PCR was performed using TB Green® Premix Ex Taq™ II (Takara, Japan). 25S RNA and NbActin2 were used as internal references for DNA and RNA normalization ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The PCR products were sequenced by primer walking and Sanger sequencing with Takara LA Taq (Takara, Japan), a dGTP BigDye Terminator Cycle Sequencing FS Ready Reaction Kit (Thermo) ...
-
bioRxiv - Neuroscience 2020Quote: ... Physical viral titer was determined using either Lenti-X qRT-PCR Titration Kit (Takara, Mountain View, CA) or qPCR Lentivirus Titration Kit (Applied Biological Materials Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... The genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara Bio).
-
bioRxiv - Physiology 2021Quote: ... 1 μg RNA was used to synthesize first strand of cDNA using PrimeScriptTM RT-PCR Kit (TaKaRa). qPCR was conducted using PrimeScriptTMRT Master Mix (TaKaRa ...
-
bioRxiv - Plant Biology 2021Quote: ... Applied Biosystem StepOne real-time PCR system and SYBR Premix Ex Taq II kit (Takara, Dalian, China) were used for the qRT-PCR detection ...
-
bioRxiv - Microbiology 2021Quote: ... RNase H-treated cDNA was used as a template for PCR with PrimeStar GXL Polymerase (Takara, Japan) and primers listed in Supplementary table 7 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and used for first-strand cDNA synthesis using the First-Strand Synthesis System for RT-PCR (Takara). Each sample was processed in triplicate ...
-
bioRxiv - Microbiology 2022Quote: ... Two PCR products were inserted into the vector backbone using In-Fusion HD Cloning Kit (Takara Bio) to generate pLJM1-LTR-FT ...
-
bioRxiv - Molecular Biology 2022Quote: ... the JAK3 open reading frame was amplified by PCR using the Advantage 2 polymerase mix (Takara Bio) with JAK3-ORF primers (Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: ... The resulting cDNA was subjected to relative quantitative PCR using a SYBR Premix Ex TaqTM kit (TaKaRa) on a Roche LightCycler 480 real-time PCR machine ...
-
bioRxiv - Plant Biology 2022Quote: ... One microgram DNAse-treated RNA was converted to cDNA using Prime RT-PCR kit (Takara Bio Inc.). The qRT-PCR was performed on 11 selected DEGs containing DRE elements ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCR reactions were performed using the Takara TP-850 thermal cycler (Takara Bio, Japan, www.takara-bio.com) and THUNDERBIRDTM SYBR® qPCR Mix from Toyobo (https://www.toyobo.co.jp) ...
-
bioRxiv - Molecular Biology 2022Quote: ... And realtime PCR amplification of the cDNAs were performed with SYBR® Premix Ex Taq™ (TAKARA) kit in ABI 7500 realtime-PCR system ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA used for RT-PCR was synthesized using the PrimeScrip First-Strand cDNA Synthesis Kit (TaKaRa). RT-PCR cycling conditions were as follows ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR fragments were sequenced and individual nanobodies were cloned using the In-Fusion cloning kit (Takara Bio) into a pET28a vector linearised by PCR with primers NbLib_pET28a_fwd (GGTGACCGTGAGCAGCCACCACCACCACCACCACTGAGATCCGGCTGCTAAC AAAGC ...
-
bioRxiv - Microbiology 2021Quote: ... Each RNA sample was reverse transcribed to 50 μl cDNA with RT-PCR Prime Script Kit (Takara). The cDNA (5 μl ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reverse-transcription and cDNA amplification were performed with SMARTer® PCR cDNA Synthesis Kit (Clontech Laboratories, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR reactions were performed using a SYBR® Premix Ex Taq™ II Kit (TaKaRa, China) and a CFX96 real-time PCR detection system (BIO-RAD ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative PCR reactions were performed using the Takara TP-850 thermal cycler (Takara Bio, Japan, www.takara-bio.com) and SsoAdvancedTM Universal SYBR® Green Supermix (BIO-RAD ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative PCR was performed for the target genes using SYBR Premier Ex Taq (Takara; Cat No. RR420L) and quantified using the QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative PCR assays were performed on a qTOWER apparatus (Analytic Jena) using SYBR Green master mix (TaKaRa). Gene expression was normalized for the expression of 36B4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR amplified EHMT1-Ankyrin and SET products were then cloned into pEGFPC1 vector (6084-1, Clontech) to generate the plasmid constructs ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... qRT-PCR assays were carried out using the SYBR PrimeScript™ RT reagent Kit (TaKaRa, Kusatsu, Japan) following manufacturer‟s instructions and ABI 7500 Software v2.0.6 (Applied Biosystems ...
-
bioRxiv - Plant Biology 2019Quote: ... qRT-PCR was performed using SYBR® Premix EX Taq™ and Thermal Cycler Dice® (TaKaRa). Plastid genes ...
-
bioRxiv - Bioengineering 2020Quote: Expression constructs were cloned using standard PCR methods and In-Fusion® HD Cloning (TaKaRa Bio Europe). Primers were ordered from Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: All PCR amplification and insertion into plasmids were performed with PrimeSTAR MAX and In-Fusion HD (TaKaRa), respectively.
-
bioRxiv - Molecular Biology 2020Quote: ... the amplified PCR products were cloned into a T/A cloning vector PMD18-T (TaKaRa, Tokyo, Japan), and later excised from PMD18-T plasmid using NotI and XhoI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... Viral titer was determined using a qPCR Lentivirus Titration Kit (Lenti-X, qRT-PCR Titration Kit, Takara). For smaller scale virus preparation ...
-
bioRxiv - Biophysics 2019Quote: ... Excess primers were removed from the PCR products using NucleoSpin silica-membrane columns (Clontech, Mountain View, CA) and the products were further purified in 3% agarose-TBE gels and subsequently reisolated using gel-purification kits (Clontech).
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... Sequences of the PCR amplicons were determined by commercial Sanger-sequencing service (Takara Bio Inc. Kusatsu, Japan). Sequences of all reference haplotypes are listed in Table S1 and deposited to the DNA database of Japan (Accession number ...
-
bioRxiv - Cell Biology 2021Quote: ... Transformants were screened by colony PCR using the primer set JT37/JT38 and Sapphire polymerase (Takara Bio), and positive clones were selected for outgrowth ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR was performed on 100 ng genomic DNA using PrimeStar GXL SP DNA polymerase (Takara Bio RF220Q) to check exon 3 integrity and plasmid insertion using the following primers:
-
bioRxiv - Neuroscience 2020Quote: ... RNA was extracted and cDNA was synthesized by PCR (PrimeScript RT reagent kit with gDNA Eraser, TaKaRa). SaCas9 was amplified by PCR with Q5 High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry was introduced into the PIN2 construct by inverse PCR followed by an In-Fusion reaction (Clontech). The SNAP-tag with an N-terminal secretion signal peptide sequence (MKTNLFLFLIFSLLLSLSSAEF ...