Labshake search
Citations for Takara Bio :
1351 - 1400 of 2391 citations for PCR Tube since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA from the total RNA was synthesized using the Advantage® RT-for-PCR kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (RR096A, Takara Bio Inc.), and primer pairs for Zcchc3 (5′-CTCTCTATGCCTTCTTAAACCGA-3′ and 5′-CATCTGCACGCTACAGTTCT-3′ ...
-
bioRxiv - Immunology 2023Quote: ... The viral copies were quantitated by reverse transcription quantitative PCR following the handbook (Takara, Cat.#RR086A). The copy numbers of reverse-transcripts from cell cultures and mice organ samples were normalized with the expression level housekeeping gene of beta-actin by using the 2(-Delta Delta C(T) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was generated from the adapter ligated RNA using the SMARTer PCR cDNA Synthesis Kit (Clontech), replacing the CDS Primer IIA with a custom primer complementary to the 3′ end adapter for first strand synthesis (TableS6) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR for selection cassette production was performed with SeqAmp DNA Polymerase (Takara Bio, cat. no. 63850) using the ultramers as primers and AAT-PB-CD2APtk (Addgene #86004 ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR condition modifications to amplify RACE products are as followed using SeqAmp DNA Polymerase (Takara Bio): Fat1 (TA ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed with a Takara Thermal Cycler Dice® Touch (Takara Bio, Kusatsu, Japan). The RT-PCR program was as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... Viral titer was quantified using the Lenti-X™ qRT-PCR Titration Kit (Takara Bio, #631235), according to manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR was performed using TaKaRa PrimeSTAR GXL DNA Polymerase following the manufacturer’s protocol (Takara Biotechnology, Japan). Amplified DNA fragments were purified by illustra ExoProStar (GE Healthcare Life Sciences) ...
-
bioRxiv - Plant Biology 2023Quote: The truncated version of the RPF2nad6 was generated by PCR amplification using Takara PrimeStar polymerase (TaKaRa) and a primer pair designed to remove the last 180 nucleotides of the RPF2nad6 coding sequence representing the RfCTD sequence (Supplementary table 6) ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was amplified with V3d(T)24 and R2SP primers and Terra PCR Direct Polymerase (Clontech) for 16 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifying PCR of the first stand cDNA product was then performed using SeqAmp DNA Polymerase (Takara) with a nested 3’ primer to the constant genes and a 5’ universal primer based on universal primer sites added to the 5’ end during cDNA generation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The first step of cDNA synthesis was done using the SMARTer PCR cDNA Synthesis Kit (Takara). Then ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription and amplification were performed using One Step PrimeScript™ RT-PCR Kit (Takara, Japan) and reaction performed and visualized using Stratagene Mx3000P qPCR System real-time PCR system (Agilent ...
-
bioRxiv - Biochemistry 2024Quote: The SUGCT coding sequence was amplified by PCR by using PrimeStar GXL polymerase (Takara Bio Inc) using the following primers (start and stop codon in bold) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Mycoplasma contamination in cell cultures was routinely tested using the PCR mycoplasma detection set (Takara Bio). At approximately 70% confluence ...
-
bioRxiv - Neuroscience 2024Quote: ... RT–PCR was performed using a TB Green TM Premix Ex Taq Kit (Cat# RR820A, Takara) on a Light Cycler Real-Time PCR System (480II ...
-
bioRxiv - Plant Biology 2024Quote: 0.1uL DNA templates were mixed with 10uL Emerald Amp Max PCR Master (Takara Bío. co., Japan) and 0.2uL of 10uM primer set up to 20ul with distilled water for 1st PCR analysis ...
-
bioRxiv - Molecular Biology 2024Quote: ... All constructs were cloned using PCR amplification of complimentary fragments and In-Fusion HD assembly (Takara). pRRL-hPGK-mCherry-P2A-PuroR-T2A-FLAG-APEX2 was created by PCR amplifying hPGK-mCherry-P2A-PuroR-T2A from a synthesised gene fragment purchased from GeneWiz and APEX2 from pcDNA3-FLAG-APEX2-NES (a gift from Alice Ting67 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV was titrated using quantitative PCR (qPCR) with primers for the ITR sequence (TaKaRa Bio Inc).
-
bioRxiv - Neuroscience 2024Quote: ... The titer of AAV was determined with a real-time PCR thermal cycler (Dice, Takara Bio). The resultant AAV1-Syn-mCherry (2.8 × 1012 GC/ml) ...
-
bioRxiv - Microbiology 2024Quote: ... Plasma viral RNA copy numbers were determined via SYBR green-based real-time quantitative PCR (Takara), using SIV gag-specific primers (table supplement 4) ...
-
bioRxiv - Plant Biology 2024Quote: ... The SKI2 cDNA sequence was amplified from wild type cDNA using CloneAmp HiFi PCR Premix (Takara) and cloned into the pPZP212 binary vector ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and extension were all completed with the SMARTer PCR cDNA Synthesis Kit (Takara Bio Europe, France). Full-length cDNA (fl-cDNA ...
-
bioRxiv - Genomics 2023Quote: ... PCR3 products (final library) were purified with the Nucleospin Gel and PCR Cleanup kit (Takara, 740609) and eluted in 25 µL 70 °C buffer.
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-PCR was performed with the SYBR Premix Ex TaqTM kit (DRR041A, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... Real-Time PCR was performed by using specific primers and SYBR Green ROX Mix (RR420A, Takara). β-actin was used as the internal quantitative control.
-
bioRxiv - Microbiology 2024Quote: ... The PCR and CPER reaction were performed using PrimeSTAR GXL DNA polymerase (Takara Bio, Cat# R050A). The CPER product was transfected into BHK/hACE2 cells using Lipofectamine LTX (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Microbiology 2024Quote: ... Viral HA segments were PCR-amplified and cloned into pMD-18T vector (6011, TAKARA Beijing, China). Subsequently ...
-
bioRxiv - Microbiology 2024Quote: ... The HA1 subunit was divided into three fragments for PCR (PrimeSTAR Max DNA Polymerase, Takara Bio), seven Ns and partial sequencing adapters were added in the primer as the barcode ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were constructed by PCR amplification of the whole plasmids with the CloneAmp Hifi polymerase (Takara) and assembly of the insert part with the NEBuilder HiFi DNA Assembly kit ...
-
bioRxiv - Cell Biology 2020Quote: ... FAM111A cDNAs were PCR amplified and inserted into destination vectors using In-Fusion seamless cloning (Takara Bio). The pTRIPz-MycBioID vector allows for doxycycline-inducible expression of RNF4 or FAM111A with N-terminal fusion of a Myc tag and a promiscuous biotin ligase (MycBioID ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2015) with MluI and inserting PCR-amplified EGFP from pEGFP-C1 (Clontech Laboratories, Mountain View, CA, USA). Tol2-mCherry was produced by digesting Tol2-EGFP-C1 with NheI/EcoRI to remove GFP and inserting mCherry amplified by PCR from 8xGliBS-IVS2-mCherry-NLS-polyA-Tol2 (a gift from James Chen (Addgene plasmid #84604) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplifications were typically performed in 20 μL reaction volumes containing 1× EmeraldAmp GT PCR Master Mix (Takara Bio Inc. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or with standard (DreamTaq - Thermo Fisher Scientific, or EmeraldAmp Max HS PCR Master Mix - TaKaRa Bio Inc) DNA polymerases ...
-
bioRxiv - Plant Biology 2020Quote: ... The qRT-PCR reaction mixture included TB Green® Premix Ex Taq™ II (Takara, Shiga, Japan). The qRT-PCR conditions were as follows ...
-
bioRxiv - Neuroscience 2021Quote: The sgRNA sequences were amplified using Guide-it™ CRISPR Genome-Wide Library PCR Kit (Takara, 632651) and subjected to the high-throughput amplicon sequencing on NextSeq500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The first PCR products were subsequently amplified by the nested Per2AS specific primers with Universal Primer (Clontech). The nested PCR products were cloned into pGEM-T vector (Promega ...
-
bioRxiv - Genomics 2019Quote: ... 1 ng full length cDNA was used to perform 35-cycle PCR with Premix Taq™ (TaKaRa). PCR products were purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... using One Step TB Green(tm) PrimeScript(tm) RT-PCR Kit II (SYBR Green) (RR086B, TaKaRa, JAPAN). Relative copy number was determined by calculating the fold-change difference in the gene of interest relative to GAPTH ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR amplification of the vectors and the FPs was performed using CloneAmp™ DNA polymerase (Clontech, USA). The PCR products were gel purified (Macherey-Nagel ...
-
bioRxiv - Microbiology 2019Quote: ... Outside-in colony PCR of a subset of hpn genes was performed with PrimeSTAR DNA polymerase (TaKaRa) using the following primers:
-
bioRxiv - Biochemistry 2020Quote: ... were replaced by the BG505-NxT or BG505-NxS PCR fragments using the In-Fusion enzyme (Clontech) as described by the manufacturer ...
-
bioRxiv - Pathology 2019Quote: ... An aliquot of the cDNA was mixed with 25 µL SYBR® Green PCR Master Mix (TaKaRa) and 10 pmol of each specific forward and reverse primer ...
-
bioRxiv - Microbiology 2019Quote: ... the cDNA was purified and eluted in 20ul of elution buffer (NucleoSpin PCR Clean-up Kit, Clontech). The immunoglobulin PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The PCR products were extracted from agarose gel using MiniBEST Agarose Gel DNA Extraction Kit (Takara, Japan) based on manufacturer’s instructions ...