Labshake search
Citations for Takara Bio :
901 - 950 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... anti-tdTomato (Takara, Cat.# 632496), anti-K14 (Biolegend ...
-
bioRxiv - Cell Biology 2024Quote: ... was amplified and analysed in real-time polymerase chain reaction on a Roche Light Cycler 480 system with TB Green® Premix Ex Taq™ II (TaKaRa Bio Inc., Japan). The specific primers were predesigned and validated by PrimerBank of Massachusetts General Hospital (Spandidos et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Domain swapped constructs were generated by in-fusion cloning (Takara Bio). FZD(1-10)-V5-IRES-mKate constructs were a kind gift of Karl Willert (Department of Cellular & Molecular Medicine ...
-
bioRxiv - Cell Biology 2024Quote: ... SyBrGreen (Takara) was used to perform RT‒PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... and cDNA was synthesized with Superscript III cDNA-synthesis Kit (Takara). SyBrGreen (Takara ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted with Triol Reagent (Takara), and cDNA was synthesized with Superscript III cDNA-synthesis Kit (Takara) ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Immunology 2024Quote: An adenovirus plasmid encoding the first 30 amino acids of KRAS with the G12V mutation (KRAS G12V-30) was created following the manufacturer’s instructions (Adeno-X CMV, Takara Bio). Adenovirus particles were produced by transfecting the adenoviral plasmid into HEK293 cells ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and the amplified DNA samples were processed with S1 nuclease (TaKaRa) to reduce branching junctions.
-
bioRxiv - Genetics 2024Quote: ... 0.2*106 mESCs were seeded in a well of a 12-well plate in 2iL and transduced the next day with 1ml of 5x concentrated (lenti-X, Clontech) and filtered viral supernatant with 8 ng/μl polybrene (Sigma Aldrich) ...
-
bioRxiv - Genetics 2024Quote: ... oligonucleotide primers were designed to introduce the respective mutant sites using the PCR-based In-Fusion cloning technique (Takara Bio, Japan). The transgenes with human reference wildtype COL4A5 and select patient-derived variants were introduced to the 51C attP landing site on the second chromosome by Rainbow Transgenic Flies (CA ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3.3 mL of Lenti-X concentrator (Takara, cat.# 631231) were added to 10 mL of filtered SN ...
-
bioRxiv - Developmental Biology 2024Quote: ... libraries were prepared by the iGE3 Genomic Platform using the SMART-Seq v4 kit (Clontech, 634893) for the reverse transcription and cDNA amplification ...
-
bioRxiv - Developmental Biology 2024Quote: ... The purified PCR fragments were subsequently cloned into the XbaI-linearized pUASp-K10-attB vector (Koch et al., 2009) via In-Fusion reaction (#639648, Takara Bio, Japan). Plasmids confirmed to be correct were injected into embryos of nos-phiC31;;P{CaryP} attP2 (#25710 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The CDs of cdon was amplified using PCR (Prim STAR Max Premix Takara NO.R045A) and cloned into the vector PCS2+ to generate the expression constructs (5x In-Fusion HD Enzyme Premix ...
-
bioRxiv - Developmental Biology 2024Quote: We used In-Fusion enzyme (Takara Bio, #638947) to create a single nucleotide substitution on the 69th amino acid (Leucine to Stop ...
-
bioRxiv - Developmental Biology 2024Quote: ... into which a DNA fragment was inserted by In-Fusion HD Cloning Kit (TAKARA) to produce RCAS-GCaMP6s-P2A-mRuby3 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The SmartSeq v4 kit (Clontech) was used for reverse transcription and cDNA amplification ...
-
bioRxiv - Developmental Biology 2024Quote: ... and/or 1:200 anti-N-cadherin antibodies (TAKARA, M110) in 1% blocking regent (Roche ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... In-nuclei chromatin digestion to achieve 80 % monomer / 20 % oligomers nucleosome ratio was performed with MNase (Takara Bio, 2910a) 100 U per 4M nuclei for 10 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cloned into the vector PCS2+ to generate the expression constructs (5x In-Fusion HD Enzyme Premix, Takara
-
bioRxiv - Developmental Biology 2024Quote: ... For beta-catenin overexpression the CHIR99021 was substituted with 1 µg/ml doxycycline (Clontech).
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA libraries were then synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech; PT4097-1) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit anti-DsRED (1:1000; Clontech, Cat # 632496), chicken anti-GFP (1:250 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Reporter plasmid libraries were made by cloning amplified ATAC fragments into AgeI-HF- and SalI-HF-linearized pSTARR-seq plasmid using InFusion HD cloning kit (Takara) and then propagated in MegaX DH10B T1R electrocompetent bacteria ...
-
bioRxiv - Developmental Biology 2024Quote: ... low-passage 3.5×106 Hek293T Lenti-X cells (632180, Takara) were seeded per 10 cm dish (Corning ...
-
bioRxiv - Developmental Biology 2024Quote: ... Hek293T Lenti-X cells (632180, Takara) were used for making lentivirus ...
-
bioRxiv - Developmental Biology 2024Quote: ... qPCR was performed with the SYBR Premix Ex Taq kit (TaKaRa) with Rplp0 serving as the internal control ...
-
bioRxiv - Developmental Biology 2024Quote: ... Primary antibodies used were CDH1 (E-CADHERIN) (M106, Takara Biosciences) for glandular and luminal epithelial staining ...
-
bioRxiv - Developmental Biology 2024Quote: ... Foamy virus was produced using Lenti-X 293T (Takara Bio, Kusatsu) generated as previously described and frozen at -80°C for long term storage42 ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were heat-shock transformed into stellar competent cells (Takara Bio, Kusatsu). SOC outgrowth was performed for 1 hour at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were generated and sequencing was performed by the NY Genome Technology Center with a low input SMART-Seq HT with Nxt HT kit (Clontech Laboratories, 634947) and SP100 cycle flow cell ...
-
bioRxiv - Developmental Biology 2024Quote: ... anti-Ds-Red (rabbit, 632496; Clontech; 1:500), anti-mCherry (chicken ...
-
bioRxiv - Developmental Biology 2024Quote: Using the Cogent NGS Analysis Pipeline software v 1.5.1 (Takara), FASTQ files containing all indices for each chip were demultiplexed to FASTQ files containing one index per file ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 20 minutes on ice and then dispensed into the nano-well plates of the ICELL8® cx Single-Cell System (Takara). Wells containing single viable cells were automatically selected using the ICELL8 cx CellSelect v2.5 Software (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... The library for sequencing was then prepared using the SMART-Seq ICELL8 application kit (Takara) following the manufacturer’s recommended protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... the SMART-seq v4 Ultra Low Input RNA kit (Takara) was used to prepare cDNAs starting from 1.5 µg of total RNA for each sample and sequencing libraries were prepared subsequently prepared using the Ovation Ultralow System V2 (NuGen) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Wells containing single viable cells were automatically selected using the ICELL8 cx CellSelect v2.5 Software (Takara) with the green and not red logic ...
-
bioRxiv - Developmental Biology 2024Quote: ... linker italics) were used to PCR amplify (Takara PrimeStar Max) the homology repair template (HRT) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Library construction started from 4.9ng of RNA per sample made using the SMARTer Stranded Total RNA-seq Kit v3-Pico Input Mammalian (Takara; 634486). The quality of libraries was checked with the with the High Sensitivity DNA Reagents Kit (Agilent ...
-
bioRxiv - Genomics 2024Quote: ... Library construction was performed based on the manufacturer’s recommendation for SmarterStranded V2 kit (Takara Bio, California, USA). The final library quantity was measured by KAPA SYBR FAST qPCR and library quality was evaluated by TapeStation D1000 ScreenTape (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: ... wherein 2.5 µg of pooled plasmid was diluted with Xfect reaction buffer (Takara Bio, 631318) to a total volume of 50 μL ...
-
bioRxiv - Immunology 2024Quote: ... cDNA libraries were prepared using SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Quantified PCR was performed using SYBR Premix Ex Taq Kit (Takara Bio Inc., Japan), and carried out on ABI Prism 7000 sequence detection system (Applied Biosystems USA) ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was extracted using the RNAiso Plus kit (Takara, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: RNA extract used for sequencing above was treated with RNase-Free DNase (Takara) to remove contaminated DNA ...
-
bioRxiv - Microbiology 2024Quote: ... and cDNA was synthesized using the M-MLV Reverse Transcriptase cDNA Synthesis Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... membrane and concentrated up to 10-fold using Lenti-X Concentrator (TaKaRa). The virus pellet was resuspended in 100 µL of Phosphate Buffered Saline (PBS ...
-
bioRxiv - Microbiology 2024Quote: ... The reverse transcription was performed using the PrimeScript RT reagent kit (Takara, Saint-Germain-en-Laye, France) with a primer oligo-d(T)-AP (5’ GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTv 3’) ...
-
bioRxiv - Microbiology 2024Quote: ... PCR DNA amplifications were performed with CloneAmp HiFi PCR premix (Takara) using Primer-AP (5’ GACCACGCGTATCGATGTCGAC 3’ ...