Labshake search
Citations for Takara Bio :
751 - 800 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... rabbit anti-Dsred (Takara, 632496), rabbit anti-VAChT (SYSY ...
-
bioRxiv - Cell Biology 2024Quote: ... Virus was produced by Lenti-X™ 293T cells (Takara Bio USA), transfected with lentiviral expression vector (330 ng) ...
-
bioRxiv - Cell Biology 2024Quote: ... the titers of the generated AAV vectors were determined by Takara-AAVpro Titration Kit (for Real Time PCR) ...
-
bioRxiv - Cell Biology 2024Quote: ... Ver.2 (Takara, cat# 6233), as per manufacturer’s protocol.
-
bioRxiv - Cell Biology 2024Quote: ... Viruses were purified with AAVpro Purification Kit Maxi (All Serotypes) (Takara, cat# 6666), as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1μg/ml doxycycline (Clontech). Cells were incubated at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quantitative PCR (qPCR) was performed on the CFX Connect Real-Time PCR Detection System using SYBR Green PCR Master Mix (TaKaRa). Primer pairs used were listed in Supplementary (Table S2) ...
-
bioRxiv - Developmental Biology 2024Quote: ... PrimeStar Max (Takara) or PrimeStar GXL (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... Lenti-X 293T cells were acquired from Clontech (632180). Adult dermal fibroblasts were acquired from Coriell (GM02171 ...
-
bioRxiv - Developmental Biology 2024Quote: ... or PrimeStar GXL (Takara) were used ...
-
bioRxiv - Developmental Biology 2024Quote: ... were used to PCR amplify the homology repair template (Takara PrimeStar Max). After purification (Promega Wizard SV Gel and PCR clean-up system) ...
-
bioRxiv - Cell Biology 2024Quote: ... A bicistronic construct expressing human EPAC1b with a C-terminal His10 tag and SUMO3(Q89K) was constructed using the pIRES2-EGFP vector (Clontech Catalog no. 632435). The EPAC1-His10-IRES-SUMO3(Q89K ...
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... where the entire ORF of the corresponding gene was inserted in frame into the pGADT7 (GAL4 activation domain) or pGBKT7 (GAL4 binding domain) plasmid (Clontech).
-
bioRxiv - Cell Biology 2024Quote: ... Two-hybrid interaction was tested with YNB medium lacking histidine in Saccharomyces cerevisiae strain AH109 (Clontech).
-
bioRxiv - Cell Biology 2024Quote: ... Supernatants were loaded on 5 mL of TALON beads (Takara Bio) pre-equilibrated with the lysis buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... in a final volume of 600 μl for 15 min before the transfection mix was added to subconfluent (80-90%) Lenti-X 293T cells (Clontech) grown on a 10-cm tissue culture dish ...
-
bioRxiv - Cell Biology 2024Quote: ... The virus titer was determined using Lenti-X GoStix Plus (Clontech). To transduce hTCEpi cells ...
-
bioRxiv - Cell Biology 2024Quote: ... clarified supernatant was combined with Lenti-X concentrator (Clontech) at a 3-to-1 volume ratio ...
-
bioRxiv - Cell Biology 2024Quote: ... Three nanograms of total RNA were used for amplification using the SMART-Seq V4 Ultra Low Input RNA kit (Clontech) according to the manufacturer’s recommendations (10 PCR cycles were performed) ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-tdTomato (Takara, Cat.# 632496), anti-K14 (Biolegend ...
-
bioRxiv - Cell Biology 2024Quote: ... was amplified and analysed in real-time polymerase chain reaction on a Roche Light Cycler 480 system with TB Green® Premix Ex Taq™ II (TaKaRa Bio Inc., Japan). The specific primers were predesigned and validated by PrimerBank of Massachusetts General Hospital (Spandidos et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Domain swapped constructs were generated by in-fusion cloning (Takara Bio). FZD(1-10)-V5-IRES-mKate constructs were a kind gift of Karl Willert (Department of Cellular & Molecular Medicine ...
-
bioRxiv - Cell Biology 2024Quote: ... SyBrGreen (Takara) was used to perform RT‒PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... and cDNA was synthesized with Superscript III cDNA-synthesis Kit (Takara). SyBrGreen (Takara ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted with Triol Reagent (Takara), and cDNA was synthesized with Superscript III cDNA-synthesis Kit (Takara) ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Immunology 2024Quote: An adenovirus plasmid encoding the first 30 amino acids of KRAS with the G12V mutation (KRAS G12V-30) was created following the manufacturer’s instructions (Adeno-X CMV, Takara Bio). Adenovirus particles were produced by transfecting the adenoviral plasmid into HEK293 cells ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and the amplified DNA samples were processed with S1 nuclease (TaKaRa) to reduce branching junctions.
-
bioRxiv - Genetics 2024Quote: ... 0.2*106 mESCs were seeded in a well of a 12-well plate in 2iL and transduced the next day with 1ml of 5x concentrated (lenti-X, Clontech) and filtered viral supernatant with 8 ng/μl polybrene (Sigma Aldrich) ...
-
bioRxiv - Genetics 2024Quote: ... oligonucleotide primers were designed to introduce the respective mutant sites using the PCR-based In-Fusion cloning technique (Takara Bio, Japan). The transgenes with human reference wildtype COL4A5 and select patient-derived variants were introduced to the 51C attP landing site on the second chromosome by Rainbow Transgenic Flies (CA ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3.3 mL of Lenti-X concentrator (Takara, cat.# 631231) were added to 10 mL of filtered SN ...
-
bioRxiv - Developmental Biology 2024Quote: ... libraries were prepared by the iGE3 Genomic Platform using the SMART-Seq v4 kit (Clontech, 634893) for the reverse transcription and cDNA amplification ...
-
bioRxiv - Developmental Biology 2024Quote: ... The purified PCR fragments were subsequently cloned into the XbaI-linearized pUASp-K10-attB vector (Koch et al., 2009) via In-Fusion reaction (#639648, Takara Bio, Japan). Plasmids confirmed to be correct were injected into embryos of nos-phiC31;;P{CaryP} attP2 (#25710 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The CDs of cdon was amplified using PCR (Prim STAR Max Premix Takara NO.R045A) and cloned into the vector PCS2+ to generate the expression constructs (5x In-Fusion HD Enzyme Premix ...
-
bioRxiv - Developmental Biology 2024Quote: We used In-Fusion enzyme (Takara Bio, #638947) to create a single nucleotide substitution on the 69th amino acid (Leucine to Stop ...
-
bioRxiv - Developmental Biology 2024Quote: ... into which a DNA fragment was inserted by In-Fusion HD Cloning Kit (TAKARA) to produce RCAS-GCaMP6s-P2A-mRuby3 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The SmartSeq v4 kit (Clontech) was used for reverse transcription and cDNA amplification ...
-
bioRxiv - Developmental Biology 2024Quote: ... and/or 1:200 anti-N-cadherin antibodies (TAKARA, M110) in 1% blocking regent (Roche ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... In-nuclei chromatin digestion to achieve 80 % monomer / 20 % oligomers nucleosome ratio was performed with MNase (Takara Bio, 2910a) 100 U per 4M nuclei for 10 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cloned into the vector PCS2+ to generate the expression constructs (5x In-Fusion HD Enzyme Premix, Takara
-
bioRxiv - Developmental Biology 2024Quote: ... For beta-catenin overexpression the CHIR99021 was substituted with 1 µg/ml doxycycline (Clontech).
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA libraries were then synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech; PT4097-1) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit anti-DsRED (1:1000; Clontech, Cat # 632496), chicken anti-GFP (1:250 ...
-
bioRxiv - Developmental Biology 2024Quote: ... low-passage 3.5×106 Hek293T Lenti-X cells (632180, Takara) were seeded per 10 cm dish (Corning ...
-
bioRxiv - Developmental Biology 2024Quote: ... Hek293T Lenti-X cells (632180, Takara) were used for making lentivirus ...
-
bioRxiv - Developmental Biology 2024Quote: ... Primary antibodies used were CDH1 (E-CADHERIN) (M106, Takara Biosciences) for glandular and luminal epithelial staining ...
-
bioRxiv - Developmental Biology 2024Quote: ... Foamy virus was produced using Lenti-X 293T (Takara Bio, Kusatsu) generated as previously described and frozen at -80°C for long term storage42 ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were heat-shock transformed into stellar competent cells (Takara Bio, Kusatsu). SOC outgrowth was performed for 1 hour at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were generated and sequencing was performed by the NY Genome Technology Center with a low input SMART-Seq HT with Nxt HT kit (Clontech Laboratories, 634947) and SP100 cycle flow cell ...