Labshake search
Citations for Takara Bio :
8201 - 8250 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: The coding sequence of human PAC (NP_060722) previously subcloned into pIRES2-EGFP vector (Clontech) using XhoI and EcoRI restriction enzyme sites9 was used for whole-cell patch clamp recording ...
-
bioRxiv - Biophysics 2022Quote: ... B/B homodimeriser (AP20187, Takara Bio), dibenzocyclooctyne-PEG4-maleimide (760676 ...
-
bioRxiv - Biophysics 2022Quote: ... and ACE2 was purified by nickel affinity chromatography using His60 Ni Superflow Resin (Takara) followed by size exclusion chromatography on a Superdex 200 column (Cytiva ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lenti-X 293T cells (Clontech, 632180) were cultured in DMEM (Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... with lentivirus for 8h at an optimized dilution determined with the Lenti-X GoStix Plus protocol (Takara, 631280). CHAC1 and SLC25A39 knockout cells were generated using the pLenti-CRISPR-V2 plasmid (Addgene ...
-
bioRxiv - Biophysics 2022Quote: ... The DNA shuffling reaction was carried out using PrimeSTAR HS DNA polymerase (Takara, Mountain View, CA) and pDS170 plasmids carrying the parent templates enNTS1ΔM10 (containing no methionine residues ...
-
bioRxiv - Biophysics 2022Quote: ... We use 25nM apoptosis inducer AP20187 (Takara, 635059) to trigger the apoptosis of ind-MCF10A cells.
-
bioRxiv - Cancer Biology 2022Quote: ... MG63.3 libraries were prepared using the Takara SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634411) while 143b-HOS-GFP libraries were prepared using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and TB Green Premix Ex Taq I (Takara Bio, Shiga, Japan) to detect messenger ribonucleic acid (mRNA) ...
-
bioRxiv - Cancer Biology 2022Quote: The total RNA from the brain tissues of all experimental groups were isolated using TRIZOL reagent (Takara Bio, Shiga, Japan) and the respective complementary deoxyribonucleic acid (c-DNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentivirus was produced with LentiX Packaging Single Shots (Clontech, 631278) according to the manufacturer’s protocol and was used to transduce MG63.3-GFP-Cas9i cells at an MOI of ∼0.3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... while 143b-HOS-GFP libraries were prepared using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara). All libraries were sequenced paired-end 100/150bp.
-
bioRxiv - Cancer Biology 2022Quote: Viral particles were generated by transfecting the lentiviral construct into HEK-293T cells using Lenti-X Packaging Single Shots (Clontech). 48 hours after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... on agar plates containing indicated concentration of AureobasidinA (Clontech), Calcofluor White (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... the SCD medium was supplemented with 5 μM AureobasidinA (Clontech), diluted from a 5 mM stock solution (in ethanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reverse transcription was performed using the M-MLV reverse system (Takara) to obtain cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and PrimeScript (Takara Bio, Dalian, China), according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... cereviseae strains Y2HGold and Y187 were used for Yeast Two Hybrid assay (Takara Bio, Mountain View, USA).
-
bioRxiv - Cell Biology 2022Quote: Tissue total RNA was extracted by The Trizol RNA Reagent (Takara, Dalian, China). The concentration and integrity of the RNA were measured by the ND-1000 Nanodrop and the Agilent 2100 TapeStation (Novogene Bioinformatic Technology ...
-
bioRxiv - Cell Biology 2022Quote: For transient rescue of the ATG9A KO cell line, 3xFLAG-ATG9A was subcloned from pCMV-10-3xFLAG-ATG9A (described in (Ghanbarpour et al., 2021)) into pLVX-puro (Clontech; 632159) for stable cell line creation ...
-
bioRxiv - Cell Biology 2022Quote: ... The cells were then treated with 2 μg/mL puromycin (Clontech; 631306) under selection for at least 1 week ...
-
bioRxiv - Cell Biology 2022Quote: ... Res-Meis1-HdL and mutated forms of Atoh1 S328A and S328D were generated following the mutagenesis protocol of PrimeStarMax (Takara). The primers we used to create Res-Meis1-HdL were GAGCAGGCCCCTTTACCCTTCTGAAGAACA and TAAAGGGGCCTGCTCACTGCTGTTATCCCC ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviruses containing guide RNAs targeting GORAB were created in HEK293 Lenti-X cells (Takara 31966021) plated on 10 cm dishes the day before transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... respectively (all based on original vectors from Clontech Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... a polymerase chain reaction using 5’-TCTAGAGCTACTAACTTCAGCCTGCTG-3’ / 5’ - CGGTGGATCCCCTTCTTCC-3’ primers on Ibidi USA 60101 LifeAct-GFPtag2 plasmid was cloned with In-Fusion HD enzyme kit (Takara) into the pLVX vector (Clontech ...
-
bioRxiv - Cell Biology 2022Quote: ... Three days post transduction virus-containing supernatants were harvested and concentrated approximately 40-fold using Lenti-X Concentrator (Clontech; Mountainview, CA). Concentrated viruses were frozen and stored at −80°C until needed ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was reverse transcribed from 500 ng of total RNA with hexamers using a PrimeScript RT reagent kit (Takara Bio, Inc., Kusatsu, Japan). qPCR was then performed in a 25 μl reaction using TB Green Premix Ex Taq II reagent (Tli RNaseH Plus ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR was then performed in a 25 μl reaction using TB Green Premix Ex Taq II reagent (Tli RNaseH Plus; Takara Bio, Inc.) on an Applied Biosystems 7500 Real-Time PCR System ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by in-frame cloning into eucaryotic expression vectors pEGFP-C1 (Clontech) or a custom-built Flag-C1 vector ...
-
bioRxiv - Cell Biology 2022Quote: The genome-wide Vienna sgRNA library was was lentivirally packaged in semiconfluent Lenti-X cells (Takara) via PEI transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... respectively) in the pZs-Green1-DR vector (Clontech).
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated using TRIZOL reagent (TaKaRa) and reverse transcripted into cDNA using HiSuperscript II kit (Vazyme ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Cell Biology 2022Quote: ... Matings between the Y2HGold and Y187 strains carrying the appropriate constructs were performed in 0.5 mL of 2X YPDA in the presence of the corresponding antibiotics following manufacturer’s instructions (Clontech’s Matchmaker Gold Yeast Two-Hybrid System, Clontech by Takara Bio, Mountain View, USA). Yeast cells were cultured at 30 ºC for 24 h and plated in SD-Trp/-Leu/X-alpha-Gal agar plates ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Cell Biology 2022Quote: ... Matings between the Y2HGold and Y187 strains carrying the appropriate constructs were performed in 0.5 mL of 2X YPDA in the presence of the corresponding antibiotics following manufacturer’s instructions (Clontech’s Matchmaker Gold Yeast Two-Hybrid System ...
-
bioRxiv - Cell Biology 2022Quote: ... Matings between the Y2HGold and Y187 strains carrying the appropriate constructs were performed in 0.5 mL of 2X YPDA in the presence of the corresponding antibiotics following manufacturer’s instructions (Clontech’s Matchmaker Gold Yeast Two-Hybrid System, Clontech by Takara Bio, Mountain View, USA). Yeast cells were cultured at 30 ºC for 24 h and plated in SD-Trp/-Leu/X-alpha-Gal agar plates ...
-
bioRxiv - Cell Biology 2022Quote: ... positive control (pGBKT7-53) and negative control bait plasmids (pGBKT7-Lam) were transformed into yeast strain Y2HGold (Takara Bio, Mountain View, USA) while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR was performed using TB Green Premix Ex TaqTM (catalog no. RR420L, Takara). Gene expression was calculated using the 2ΔΔCT method of analysis against the stable housekeeping gene TBP ...
-
bioRxiv - Cell Biology 2022Quote: ... Complementary DNA (cDNA) was prepared from 1 μg of RNA using PrimeScriptTM RT Master Mix (catalog no. RR036A, Takara). qPCR was performed using TB Green Premix Ex TaqTM (catalog no ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic DNA was purified using the Nucleospin Blood XL kit (Takara Bio, #740950.10) and amplified by index PCR with barcoded primers ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was amplified by PCR by adding 1 µl of the Terra PCR Direct Polymerase (1.25 U/µl, Takara 639270), 25 µl of the Terra PCR Direct buffer and 1 µl of the ISPCR primer (10 µM stock concentration ...
-
bioRxiv - Cell Biology 2022Quote: ... PrimeScript RT reagent kit (Takara) reverse transcribed RNA and qPT-PCR was performed by SybrGreen Supermix (Bio-Rad Laboratories) ...
-
bioRxiv - Cell Biology 2022Quote: ... The lysate was then clarified by centrifugation before loading onto a His60 Superflow Column (Clontech) and eluted in lysis buffer containing 300 mM imidazole ...
-
bioRxiv - Cell Biology 2022Quote: ... and concentrated using Lenti-X concentrator (Takara Bio, Catalog #: 631231). The lentivirus was quantified with the qPCR lentivirus titration kit (Applied Biological Materials ...
-
bioRxiv - Cell Biology 2022Quote: ... the first-strand cDNA was synthesized by using PrimeScriptTM RT reagent kit (Takara). Quantitative PCR analysis was performed with SYBR Premix Ex Taq II on AriaMx Real-time PCR system (Agilent) ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were subjected to 4-20% SDS-PAGE and analyzed by immunoblotting with the following primary antibodies: anti-GFP mouse monoclonal antibody (JL-8, Takara), GFP rabbit polyclonal antibody (PABG1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... respectively) of PCR were performed to amplify the embryo cDNA using the TaKaRa ExTaq HS (TAKRR006B, Takara, final concentration : 0.05U/mL) and IS PCR primer (IDT ...
-
bioRxiv - Developmental Biology 2022Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Developmental Biology 2022Quote: ... Following purification with Zymoclean Gel DNA Recovery Kit (ZD4008, Takara), product size distribution and quantity were assessed on a Bioanalyzer using an Agilent 2100 high-sensitivity DNA assay kit (5067-4626 ...