Labshake search
Citations for Takara Bio :
8101 - 8150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and was cloned into the pLVX-IRES-puro vector (Clontech). The GFP-AktPH construct was obtained from the laboratory of Jason Haugh (North Carolina State University ...
-
bioRxiv - Cell Biology 2022Quote: ... and was cloned into the pLVX-IRES-puro vector (Clontech). The BioID2 construct was obtained from Addgene (Addgene plasmid # 74223 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells expressing lentiviral vectors were created by following the manufacturer’s instructions for virus preparation and cell infection (Clontech). Cells were selected for expression by treatment with puromycin ...
-
bioRxiv - Cell Biology 2022Quote: ... The GFP-AktPH construct was obtained from the laboratory of Jason Haugh (North Carolina State University, Raleigh NC) (Haugh et al., 2000) and cloned into the pLVX-IRES-puro vector (Clontech). The GFP-tractin construct was a gift from Dyche Mullins (Addgene plasmid # 58473 ...
-
bioRxiv - Biochemistry 2022Quote: The Tet-On inducible expression construct pTRE3G-BI/GPR83-EGFP or pTRE3G-BI/GPR83-IRES-EGFP was transiently transfected into HEK293T cells together with the expression control vector pCMV-TRE3G (Clontech) using the transfection reagent Lipo8000 (Beyotime Technology) ...
-
bioRxiv - Biochemistry 2022Quote: The coexpression construct pTRE3G-BI/GPR83-LgBiT:SmBiT-ARRB2 and the expression control vector pCMV-TRE3G (Clontech) were cotransfected into HEK293T cells using the transfection reagent Lipo8000 (Beyotime Technology) ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR was performed using KOD DNA polymerase (Takara) with the following settings ...
-
bioRxiv - Biochemistry 2022Quote: ... All PCRs were performed using PrimeSTAR Max DNA Polymerase (Takara) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... and ligated into the multiple cloning site 2 (MCS2) of the pTRE3G-BI vector (Clontech, Mountain View, CA, USA), resulting in the construct pTRE3G-BI/GPR83-LgBiT ...
-
bioRxiv - Biochemistry 2022Quote: ... His60 Ni Superflow Resin from Takara (Mountain View, CA); 5mL GSTrap Fast Flow column from Cytiva (Marlborough ...
-
bioRxiv - Biochemistry 2022Quote: ... The DpnI (Takara Bio Inc., Otsu, Japan) treated PCR products were directly incorporated into E ...
-
bioRxiv - Biochemistry 2022Quote: ... ∞) using Tks Gflex DNA polymerase (Takara Bio Inc.) with primers F1 and R1 ...
-
bioRxiv - Biochemistry 2022Quote: ... coli and cloned into pET28a using In-Fusion cloning (Takara Bio Europe, France).
-
bioRxiv - Biochemistry 2022Quote: ... The proteins were purified using TALON Metal Affinity Resin (Takara Bio) and eluted with a buffer containing 200 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was then applied to Talon resin (Takara Bio) to purify gp5.9 using the histidine tag ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA was extracted using the hot phenol method and treated with recombinant DNase I (Takara, cat# 2270A) in the presence of RNasin Plus (Promega ...
-
bioRxiv - Biochemistry 2022Quote: PrimeScript Reverse Transcriptase (Takara, cat# 2680A) was used for reverse transcription according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... The ZIP4 coding sequence was inserted into a modified pEGFP-N1 vector (Clontech) in which the downstream EGFP gene was deleted and an HA tag was added at the C-terminus ...
-
bioRxiv - Biochemistry 2022Quote: ... An Abc2P68A mutant variant was generated using In-Fusion cloning (Takara-Bio) for the generation of RecBCD-Abc2 complex without the co-purification of the host PpiB protein ...
-
bioRxiv - Biochemistry 2022Quote: ... the RNAs of 150µl of the supernatant were extracted and quantified using Retro-X™ qRT-PCR Titration Kit (Takara, cat# 631453), according to the manufacturer instruction.
-
bioRxiv - Bioengineering 2022Quote: ... EGFP was detected using the JL-8 mouse monoclonal antibody (Clontech). For IHC ...
-
bioRxiv - Bioengineering 2022Quote: ... coli strain JM109 (Takara Biochemicals, Shiga, Japan) was used as the host for DNA manipulation and sensor strain construction ...
-
bioRxiv - Bioengineering 2022Quote: ... The enzymes used for DNA manipulation were purchased from TaKaRa Bio Inc ...
-
bioRxiv - Biophysics 2022Quote: ... LX-293 HEK cells (Clontech) were co-transfected with LentiCRISPRv1 or LentiCRISPRv2 ...
-
bioRxiv - Biochemistry 2022Quote: ... passed through Ni-NTA spin column (Takara Clontech), washed and column eluted with 500 mM Imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... the cleared lysates were incubated with 250 μL of TALON metal affinity resin (Clontech, 635502) for 1hr at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined using the BCA protein assay kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Snap-frozen cells were thawed on ice and RNA extracted with Takara’s Nucleospin RNA Plus kit (Takara Cat. # 740984.50) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... LentiX-293T packaging cells were obtained from Clontech/Takara Bio (Mountain View ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviral transductions were performed by loading the viral supernatant on 50 μg/mL retronectin-coated (Takara) non-tissue 6-well plates prior to centrifugation (2000 x g ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Bioengineering 2022Quote: ... the 96-well plate can be coated with RetroNectin® (Clontech/Takara; 12µg/ml PBS according to manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmids were propagated using heat-shocked Stellar cells (Takara, Mountain View ...
-
bioRxiv - Biochemistry 2022Quote: ... coli (gBlock Gene Fragment, IDT Singapore), were inserted into the pOPINB vector (Berrow et al., 2007) using in-fusion cloning (Takara Bio). UBE1 ...
-
bioRxiv - Biochemistry 2022Quote: ... NFkB-luciferase was purchased from Clontech. Nickase-Ninja TRB3 gRNA plasmids were purchased from ATUM Bioscience (Newark ...
-
bioRxiv - Biochemistry 2022Quote: ... Total RNA was isolated using RNAqueous isolation kit (Thermo-Fisher, Waltham MA) and mRNA reverse transcribed using PrimeScript RT Reagent Kit (Takara Bio USA, Mountain View CA). Quantitative PCR reactions were carried out using PowerUp SYBR-Green master mix using StepOne Real-Time PCR systems (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was cleared by centrifugation and incubated with TALON (Clontech) resin overnight ...
-
bioRxiv - Biophysics 2022Quote: ... and PrimeSTAR Max DNA Polymerase (Takara Bio Inc., Japan), and all mutations were confirmed by DNA sequencing.
-
bioRxiv - Cancer Biology 2022Quote: ... pmCherry-KRASG12V construct was generated by replacing pmGFP from pmGFP-KRASG12V with pmCherry from pmCherry-C1 vector (Clontech Laboratories Inc.) using NheI and BsrGI restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... with SMART-Seq Stranded Kits (Takara Bio, USA) to reach at least 50 Mio ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell survival was then quantified versus a DMSO/vehicle control by WST-1 (Takara Bio, Catalog #MK400) or AlamarBlue (ThermoFisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... according to manufacturer’s instructions (Takara). Lentivirus titers were determined by infection of HEK293T cells as biological infectious units.
-
bioRxiv - Biophysics 2022Quote: ... Lenti-X 293T cells (Takara Bio) were transfected with pTether hFzd5CRD-1TM ...
-
bioRxiv - Biophysics 2022Quote: HeLa Tet-On cells (TaKaRa) were cultured in high glucose (4.5 g/L ...
-
bioRxiv - Biophysics 2022Quote: ... The cell culture medium was replaced with pre-warmed DMEM containing 10% Tet system approved FBS (Tet-free medium, TaKaRa) and 30 μL of DNA-lipid complex was added to each well ...
-
bioRxiv - Biochemistry 2022Quote: ... Pyrobest™ DNA Polymerase and PrimeSTAR HS DNA Polymerase were purchased from TaKaRa Shuzo Co ...
-
bioRxiv - Cancer Biology 2022Quote: Telomerase-mediated extension and subsequent amplification of TRAP products were conducted in 25-µL reactions containing 1 µL of cell lysate and 2 U of Titanium Taq DNA polymerase (Takara). The other kit components—TRAP reaction buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was generated from the captured cells as per the manufacturer’s protocol using SMART-Seq Ultra Low RNA (Takara Bio; 634833) before being processed for Illumina sequencing via the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... Produced CAR lentiviruses were concentrated with the Lenti-X Concentrator (Takara Bio, 631232) to increase virus concentration (20X-100X) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CDC14Br (Table S4) and inserted in place of SV40 UTR and poly (A) sequences in pGL3-SV40 using in-Fusion (Takara). Mutations were generated in 3’ UTR sequences using In-Fusion and mutagenic primers PCGF3-inf-f ...