Labshake search
Citations for Mirus Bio :
201 - 250 of 1473 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... using the TransIT2020 transfection reagent (Mirus Bio). Cells were harvested 48 h post-transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1 Flag-MAVS-C79F or pcDNA3.1-Flag-MAVS-CcardA expressing constructs using TransIT-LT1 transfection reagent (Mirus) before selection using 800µg/ml geneticin (G418 ...
-
bioRxiv - Neuroscience 2023Quote: ... TransIT-TKO (Mirus) transfection reagent was prepared adding 2.5μL to 100µl of media without serum ...
-
bioRxiv - Genomics 2023Quote: ... and VSV-G envelope protein using TransIT®-LT1 Transfection Reagent (Mirus) with ViralBoost Reagent (Alstem ...
-
bioRxiv - Genetics 2023Quote: ... and 305 µL of TransIT-LT1 Transfection Reagent (Mirus Bio, MIR 2300) per T175 flask ...
-
bioRxiv - Microbiology 2023Quote: ... siRNA transfections were performed with TransIT-X2 Transfection Kit (Mirus Bio) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of viral genomic RNA was transfected per well in 12-well plates through the TransIT®-mRNA Transfection Kit (Mirus Bio) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... at a ratio of 3:1 PEI:total DNA or TransIT-LT1 (Mirus) at a ratio of 3:1 TransIT:DNA ...
-
bioRxiv - Synthetic Biology 2023Quote: Cells were seeded in 96-well plates one day before transfection with TransIT-PRO transfection kit (Mirus Bio, Madison, WI, US) according to manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: ... and pMD2.g (Addgen #122259) using TransIT-LT1 (Mirus) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... were cotransfected with 1 μg psPAX2-IN/HiBiT,23 1 μg pWPI-Luc2,23 and 500 ng plasmids expressing parental S or its derivatives using TransIT-293 transfection reagent (Mirus, Cat# MIR2704) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and standard packaging vectors using the TransIT-LT1 Transfection Reagent (Mirus, MIR 2306). Supernatant was collected 48 hours post transfection ...
-
bioRxiv - Genomics 2023Quote: ... 4ug of packing plasmids psPAX.2 and 2ug of the envelope vector pMD2.G diluted in OptiMEM medium and Trans-Ltl transfection reagent (Mirus). For the generation of gRNA lentivirus ...
-
bioRxiv - Developmental Biology 2023Quote: ... Neuro2a cells were seeded in 24-well plates at 80,000 cells per well and on the next day were transfected with TransIT-LT1 Transfection Reagent (Mirus, MIR 2300), using 150 ng luciferase reporter ...
-
bioRxiv - Cancer Biology 2023Quote: ... Hoechst 33342 (Mirus) was used at a final concentration of 1 μg/mL to stain nuclei for another 15 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... TransIT-LT1 (Mirus) was used for all transfections ...
-
bioRxiv - Genomics 2023Quote: ... on Matrigel (Corning)-coated plates using a reverse transfection method and Mirus TransIT-LT1 reagent (Mirus Bio, Madison, WI) and transfected cells were transiently selected for puromycin resistance ...
-
bioRxiv - Cell Biology 2023Quote: ... while U2OS cells were transfected using TransIT-LT1 Transfection Reagent (Mirus Bio), according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed using the TransIT-PRO® Transfection Reagent & Kit (Mirus Bio). Cells were incubated at 28°C following transfection for 48h ...
-
bioRxiv - Biochemistry 2023Quote: TransIT-293 Transfection Reagent (Mirus Bio, USA; cat. no. MIR 2704)
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Biochemistry 2023Quote: ... This mix was combined with 9 μL of TransIT-LT1 (Mirus) and 15 µL of OptiMEM ...
-
bioRxiv - Biochemistry 2023Quote: ... transfected with 9 μg HA-tagged and 9 μg Flag-tagged constructs using TransIT-LT1 transfection reagents (Mirus). The transfected cells were cultured for another two days ...
-
bioRxiv - Biochemistry 2023Quote: ... with TransIT-Lenti (Mirus, #MIR 6603) in a well of a 6-well plate ...
-
bioRxiv - Biochemistry 2023Quote: ... S462 cells were transfected with the guide RNA and the repair template using TransIT LT (Mirus). Cells were selected with G418 ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cancer Biology 2023Quote: ... 300,000 cells were seeded in 6-well plates and transfected 24hrs later with 2ug of pBS-(CBR-TCR(PTC))-(CBG-TCR(WT)) plasmid68 using TransIT-LT1® (Mirus, MIR2300), following manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... TransIT-LT1 transfection reagent (Mirus Bio) and Polybrene Infection/Transfection Reagent (EMD-Millipore ...
-
bioRxiv - Bioengineering 2023Quote: ... using TransIT-X2 transfection reagent (Mirus Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were grown on coverslips and transiently transfected with mCherry Parkin and PPP3CB-Flag using Trans-IT transfection reagent (Mirus Bio) for 18 h ...
-
bioRxiv - Cell Biology 2023Quote: ... the packaging cell line HEK293-FT was transfected with pTCP-MPsfGFP together with pSAX2 (12260 Adgene) and pCMV-VSV-G (8454 Adgene) plasmids using the kit TransIT®-293 Transfection Reagent (Mirus Bio) and following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1.2 µg cytomegalovirus 8.91 vector were mixed and prepared for transfection using TransIT-293 transfection reagent (Mirus Bio) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... pRSV) and transfected into HEK293T cells using TransIT LT1 transfection reagent (Mirus Bio LLC) according to manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... and envelope vector (VSV-G) into HEK293T cells using TransIT-LT1 (Mirus Bio). Supernatant post-48/72h transfection was collected for transduction in target cells supplemented with 8 µg/mL polybrene (EMD Millipore) ...
-
bioRxiv - Cancer Biology 2023Quote: ... L-009613-00-0005 respectively) using TransIT-X2 transfection reagent (Mirus, Cat. No. MIR6003) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... Transit LT-1 reagent (cat. # MIR 2300) from Mirus Bio ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was carried out using the protocol from Mirus using the TransIT Transfection Reagent LT1 ...
-
bioRxiv - Genetics 2023Quote: ... Transfections containing 70 ng of ABE expression plasmid and 30 ng sgRNA expression plasmid mixed with 0.72 μL of TransIT-X2 (Mirus) in a total volume of 15 μL Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1.25 µg of the pCMV-VSVG envelope plasmid using TransIt-Lenti (MIR6604, Mirus). Three days after transfection ...
-
bioRxiv - Immunology 2023Quote: 293T cells were seeded in 6-well plates at 0.2M cells/ml and were transfected with TransIT-LT1 (Mirus) 24h later with 1500 ng of empty plasmid ...
-
bioRxiv - Immunology 2023Quote: ... and cells were transfected with TransIT-LT1 (Mirus) with 3 µg of vector encoding SAMD9L or pcDNA3.1 empty ...
-
bioRxiv - Immunology 2023Quote: ... cells were co-transfected with TransIT-LT1 (Mirus) with a plasmid encoding a fully replication-competent lentivirus (IMCs) ...
-
bioRxiv - Cell Biology 2023Quote: ... For the complementation assay 100ng of total DNA (1:1 ratio of plasmids) was transfected into 293T cells in 96-well plates using TansIT(R)-LT1 (Mirus) transfection reagent according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... COS-7 cells were transfected with Trans-IT LT1 (Mirus) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... The dCas9-KRAB-mCherry plasmid was mixed with the pCMV_ΔR8.91 and pMD2.G packaging vectors at a ratio of 9:8:1 with TransIT®-Lenti Transfection Reagent (Mirus) in optiMEM (Gibco ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Baculoviruses were produced by transfecting Sf9 cells with recombinant bacmids using TransIT®-Insect Transfection Reagent (Mirus, cat no. MIR 6100), grown for 7 days at 28ºC ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with 10 µg of DNA at 70-80% cell density using TransIT-LT1 (Mirus, 2300) for 293T cells and at 50-60% cell density with Lipofectamine 3000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... SUM159 cells were transfected with TransIT 2020 (Mirus).
-
bioRxiv - Molecular Biology 2023Quote: ... A transfection mix was prepared by adding 2.5 µg plasmid and 7.5 µl transfection reagent TransIT-LT1 (Mirus) in 250 µl OptiMEM medium ...
-
bioRxiv - Microbiology 2023Quote: ... MRC-5 cell monolayers were mock-transfected or transfected with sHCoV genomic RNA (1 μg/ml) using TransIT-mRNA Transfection Kit (Mirus Bio) at 33°C ...