Labshake search
Citations for Roche :
3151 - 3200 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Input and antibody-bound fractions were quantified by real-time PCR amplification with the SYBR Green mixture (Roche) using a LightCycler 480II (Roche ...
-
bioRxiv - Genomics 2021Quote: ... and one cDNA reaction product was split into two for PCR amplification using KAPA HiFi master mix (Roche) together with USER enzyme (NEB ...
-
bioRxiv - Evolutionary Biology 2021Quote: The target-enriched pools were amplified using the KAPA HiFi 2X HotStart ReadyMix PCR Kit (Roche, Basel, Switzerland) or NEBNext Q5 HotStart HiFi PCR Master Mix (New England BioLabs ...
-
bioRxiv - Genomics 2021Quote: ... The resulting cDNAs were analysed by quantitative PCR using the LightCycler 480 SYBR Green I Master reagent (Roche) and LightCycler 480 instrument (Roche ...
-
bioRxiv - Physiology 2021Quote: ... Quantitative PCR for rat Cyp7a and reference gene GAPDH was performed using FastStart Essential DNA Green Master (Roche) in an Applied Biosystems theromocycler with 45 cycles of 95°C for 20 seconds ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative real-time PCR (qPCR) was run on a LightCycler® 480 with SYBR Green I Master (Roche). All kits and machines were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The DNA was then purified, treated with RNase H (ThermoFischer, 18021071) and Proteinase K (PCR grade, Roche, 3115836001) and concentrated with the DNA Clean & Concentrator-5 kit (Zymo ...
-
bioRxiv - Microbiology 2021Quote: ... PCR product cleanup was performed with a 0.8x concentration of KAPA Pure Beads (KAPA Biosystems, Indianapolis, IN USA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... pH 7.5 and various concentrations of ADP-ribose were mixed on ice in 384-well PCR plate (Roche). Fluorescent signals were measured from 25 to 95 °C in 0.2 °C/30-s steps (excitation ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time PCR reactions were performed with SYBR Green I Master Kit and LightCycler 480 system (Roche). mRNA levels of Col4a1 were normalized to the housekeeping gene Actb or Rpl32 ...
-
bioRxiv - Immunology 2021Quote: ... A pre-amplification step of 9 PCR cycles was performed using the Kapa HiFI Hoststart kit (Kapa Biosystems). The PCR product was purified using AmpureXP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... The elution was immediately transferred to PCR cocktails prepared with KAPA HiFi HotStart ReadyMix (2x) (Kapa Biosystems, USA), forward primer (5 ‘-GATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATTACCA ACA-3’) ...
-
bioRxiv - Immunology 2021Quote: ... HA-flanked transgenes were amplified from the plasmids by PCR using the KAPA HiFi HotStart 2x Readymix (Roche) with reaction volumes > 500 µl ...
-
bioRxiv - Genomics 2021Quote: ... Ligated and purified libraries were amplified using KAPA HiFi HotStart Real-time PCR 2X Master Mix (KAPA Biosystems). Samples were amplified with 5 μL of KAPA P5 and KAPA P7 primers ...
-
bioRxiv - Genomics 2021Quote: All PCR amplifications performed in this study make use of the KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland). The amplification of the selected regions was done from MM074 genomic DNA in a 50 µl reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... The real time PCR was carried out on a Roche LightCycler system with SYBR Green Master Mix (Roche). For each strain ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid constructs used in this study (Table S3) were generated by cloning PCR products (Kapa Hifi Polymerase, Roche) obtained with oligonucleotide primers listed in Table S4 and digested with the indicated restriction enzymes (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Relative transcript levels were quantified by quantitative real-time PCR in 96-well plates with LightCycler 480 (Roche). The reaction was set by using qPCRBIO Probe Mix Hi-ROX (Nippongenetics ...
-
bioRxiv - Cell Biology 2022Quote: ... Real time PCR was performed with SYBR green as the DNA binding dye (Roche Applied Science, Mannheim, Germany) on a 7900HT Fast Real-Time PCR System (Applied Biosystems under Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Real-Time PCR was performed in a Roche LightCycler 480 using LightCycler 480 Probes Master Mix (Roche, 04707494001). No-reverse transcriptase enzyme controls were performed on a few samples in each study to ensure lack of viral or genomic DNA contamination ...
-
bioRxiv - Genetics 2022Quote: ... Precise knock-in of 3’ homologous arm was evaluated by PCR using KAPA2G Fast HotStart ReadyMix (KAPA Biosystems) with a primer set (5’-CCACTAGTTCTAGAGCGGC-3’ and 5’-GAACTGTTGGCTACTAACACTAATACTG-3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCR (qPCR) was performed using the Roche SYBR green I kit on the LightCycler480 machine (Roche Diagnostics) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μl of 1:25 diluted cDNA with water was used for real-time PCR (LightCycler 480 Roche) using SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Genomics 2022Quote: ... The short reads were obtained by preparing Illumina PCR free libraries using the Kapa Hyper Prep Kit (Roche). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... 16S rRNA V3 and V4 regions were amplified by PCR using Kapa Hifi Hotstart Ready Mix (KAPA Biosystems) with an amplicon PCR primer set (Forward ...
-
bioRxiv - Cell Biology 2024Quote: ... and quantified by using Qubit 2.0 Fluorometer as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on a single lane of a flow cell ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... The SYBR Green Dye detection system was used for quantitative real-time PCR on Light Cycler 480 (Roche). Gene-specific primers (Microsynth ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was diluted 1:3 and qRT-PCR was conducted using a SYBR Green master mix (Roche, FSUSGMMRO) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was amplified using the 2X KAPA Taq ReadyMix PCR Kit (KAPA Biosystems, now Roche Sequencing, Indianapolis, IN) for 35 cycles using an annealing temperature of 64°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Fragments were amplified by PCR in a reaction consisting of 12.5 μL KAPA HiFi HotStart DNA Polymerase (Roche), using 5uM forward and reverse primer pairs ...
-
bioRxiv - Genetics 2024Quote: ... the sequencing libraries were constructed with two rounds of PCR using KAPA HiFi HotStart ReadyMix polymerase (Roche, 7958927001). For the first round of PCR ...
-
bioRxiv - Microbiology 2024Quote: ... pH 7.5 and various concentrations of ADP-ribose were mixed on ice in 384-well PCR plate (Roche). Fluorescent signals were measured from 25 to 95 °C in 0.2 °C/30-s steps (excitation ...
-
bioRxiv - Genetics 2023Quote: The beads were resuspended in 50 µL PCR mix including 1× HiFi HotStart Readymix (Kapa Biosystems, cat #KK2602) and 0.8 μM ISPCR oligo (AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Genetics 2023Quote: ... The rAAVs were titrated by quantitative PCR using LightCycler 480 SYBR Green I Master mix (Roche, Basel, Switzerland) and inverted terminal repeat primers as described75 ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA libraries for all samples were prepared using a KAPA Hyper Prep kit and PCR-free protocol (Roche). For each genotype ...
-
bioRxiv - Biochemistry 2024Quote: ... an additional 6-cycle PCR was carried out with the HiFi HotStart Ready Mix (Kapa Biosystems, Wilmington, MA) and primers that preserve the DNA sequence ...
-
bioRxiv - Biophysics 2024Quote: ... A second PCR amplification was performed with KAPA HiFi (KAPA Biosystems; 1-μL qPCR template, 15 cycles maximum). We amplified corresponding regions of pSC101_TetR_specR with primers that linearized the backbone ...
-
bioRxiv - Microbiology 2023Quote: ... Viral genomes were quantitated by quantitative PCR (qPCR) using the LightCycler 480 1X SYBR Green master mix (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was carried out using a KAPA SYBR FAST qPCR Master Mix 2X (Kapa Biosystems, USA), a qTOWER3 G touch (Analytik Jena AG ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and end-point fluorescence level acquiring PCR amplifications were performed on a LightCycler 480 system (Roche Life Science). PCR amplification conditions were as follows ...
-
bioRxiv - Cell Biology 2022Quote: ... The resultant cDNA was subjected to real-time PCR analysis in a LightCycler 480 or LC96 instrument (Roche) with Thunderbird SYBR qPCR mix (Toyobo ...
-
bioRxiv - Genomics 2023Quote: ... and analyzed on a light cycler rapid thermal system (LightCycler®480 2.0 Real time PCR system, Roche). ChIP-qPCR results were normalized on input signal (% input) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR was performed on the cDNA with the enzyme 2X KAPA HiFi Hotstart ReadyMix (#KK2602, Roche Diagnostic, Switzerland) and the following conditions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Quantitative PCRs were performed on a Roche LightCycler480 using The LightCycler® 480 SYBR Green I Master (Roche). Cycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... and quantified by using Qubit 2.0 Fluorometer as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
-
bioRxiv - Systems Biology 2023Quote: UNDERLINED - DR sequence The pool of guide arrays was PCR amplified using KAPA HiFi 2X HotStart ReadyMix (Roche) using 20 ng of starting template per 25 μl reaction using forward and reverse primers:
-
bioRxiv - Developmental Biology 2023Quote: ... The optimal numbers of PCR cycles were pre-determined using the KAPA Real-Time Library Amplification Kit (Roche) as described previously (Tanegashima et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... or PPIA) was performed in duplicates with fast start universal SYBR Green master (ROX) PCR kit (Roche, 04913914001) using QuantStudio7 (Thermofisher) ...
-
bioRxiv - Immunology 2023Quote: ... 80 ng of genomic DNA were amplified by PCR with the Kapa Hifi HS 2x RM (Roche Diagnostics), For the first PCR ...
-
bioRxiv - Plant Biology 2023Quote: ... transferred on nylon membrane and hybridized with DIG-labelled probes obtained by PCR DIG Probe Synthesis Kit (Roche) with specific primers (see table primers list) ...