Labshake search
Citations for Roche :
3001 - 3050 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... QRT–PCR was performed in quadruplicates using the KAPA SYBR FAST qPCR Master Mix (KAPA BIOSYSTEMS, KK4610) on a LightCycler480 Real-Time PCR System (Roche ...
-
bioRxiv - Microbiology 2019Quote: ... 16S rRNA genes were amplified using KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA). Amplification conditions for fast PCR using the KAPA2G™ polymerase were as follows ...
-
bioRxiv - Physiology 2019Quote: ... taiwanensis VLB120 was isolated using the High Pure PCR Template Preparation Kit (Hoffmann-La-Roche, Basel, Switzerland). Upstream (TS1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... real-time PCR was performed on a StepOneTM system using using FastStart Universal SYBR Green Master (Roche). H2a was used as an endogenous control.
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplification was performed in a 96 well format in a Roche LC480 II instrument (Roche, Germany) with the following settings ...
-
bioRxiv - Genomics 2019Quote: ... 0.5 ng of plasmid was amplified using primers with P5 and P7 Illumina flow cell adapter sequences (Libseq_P7_For and Libseq_P5_Rev) and KAPA HiFi HotStart Real-time PCR Master Mix (2X) (Kapa Biosystems) for 17 cycles ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Amplicons were obtained after PCR amplification using Kapa HiFi HotStart Readymix kit from Kapa Biosystems (Cat# KK2602) according to the supplier’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... qRT- PCR was performed based on SYBR Green chemistry (Light Cycler 480. SYBR Green I master, Roche). SACS primers for the analysis of total SACS mRNA levels in patients and controls were ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was performed in the presence of Expand High Fidelity polymerase (Roche Diagnostics GmbH, Mannheim, Germany), 0,2 mM dNTPS ...
-
bioRxiv - Systems Biology 2020Quote: ... Quantitative PCR was done using KAPA SYBR® FAST Universal 2X qPCR Master Mix (KAPA Biosystems KK4601) and LightCycler 96 instrument (Roche) ...
-
bioRxiv - Pathology 2020Quote: ... cDNA templates were used for real-time quantitative PCR with KAPA SYBR Fast qPCR kit (KAPA Biosystems) and analyzed with the Roche LightCycler 480 ...
-
bioRxiv - Plant Biology 2021Quote: ... The real-time quantitative PCR was performed using a LightCycler 480 system (Roche Applied Science, Mannheim, Germany). A PCR master mix was prepared with the LightCycler 480 SYBR Green I Master Kit (Roche Applied Science ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was then used for quantitative PCR (qPCR) done with LightCycler 480 SYBR Green Master Mix (Roche) and run in LC480 for 40 cycles ...
-
bioRxiv - Immunology 2021Quote: ... NCR1 and NK1.1 was performed using real-time quantitative PCR (qPCR) on a LightCycler 480 II (Roche) under the following conditions ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative PCR was performed using LightCycler 480 SYBR green I Master mix and a LightCycler 480 (Roche). To confirm absence of contamination of the samples by genomic DNA ...
-
bioRxiv - Genetics 2019Quote: ... Real-time PCR (qPCR) reactions were performed using the KAPA SYBR Fast qPCR Kit (Kapa Biosystems; KK4601), with gene-specific primers in technical triplicates and in biological triplicates (Neuro2a cells) ...
-
bioRxiv - Genomics 2021Quote: ... and Oligos 19 and 18 for libraries in vector a) using KAPA HiFi PCR Master mix (Roche) in the same number of reactions as done for the reverse transcription (98 C for 2 min ...
-
bioRxiv - Genetics 2020Quote: ... Genotyping PCR reaction from expanded clones are as follows: 0.02U/uL Kapa HiFi HotStart polymerase (Roche, KR0369), 1x Kapa HiFi HotStart buffer ...
-
bioRxiv - Neuroscience 2020Quote: Quantitative PCR was performed using SYBR Green I dye with LightCycler 480 technology (Roche, Branchburg, NJ, USA). The cDNA copy number was typically quantified against a ≥5 point ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed using LightCycler FastStart DNA MasterPLUS SYBR Green I (Roche Diagnostics, Tokyo, Japan) on a LightCycler 96 (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative PCR reactions were carried out in triplicate with SYBR Green I Master Mix (Roche S-7563) on a LightCycler 480 system (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative PCR reactions were carried out in duplicates with SYBR Green I Master Mix (Roche S-7563) on a LightCycler 480 system (Roche Applied Science) ...
-
bioRxiv - Pathology 2021Quote: ... The amplification was performed on the LightCycler 480 real-time PCR instrument (Roche Diagnostics, Burgess Hill, UK) using SYBR® Premix Ex Taq™ (TaKaRa) ...
-
bioRxiv - Cancer Biology 2020Quote: ... real-time PCR was performed using the SYBR Green from Roche (Lightcycler 480 SYBR Green I Master) as per the manufacturer’s instructions using a Light Cycler II (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative real-time PCR was performed on a Roche LightCycler 480 (Roche Diagnostics, Palo Alto, CA, USA) using SYBR Premix Ex Taq II (Tli RNaseH Plus ...
-
bioRxiv - Immunology 2020Quote: ... blood and BM cells for both species) with a LightCycler® 480 Real-Time PCR System (Roche). Gene expression was then assessed with the BioMark HD (Fluidigm ...
-
bioRxiv - Immunology 2021Quote: ... Enrichment of genomic DNA fragments by ChIP was validated by Real-time PCR (LightCycler® 480, Roche) with primers (Extended Data Table IV ...
-
bioRxiv - Immunology 2021Quote: ... Real-time quantitative polymerase chain reaction (qPCR) was performed using SYBR green PCR master mix (Kapa biosystems), forward and reverse primers (200 nM) ...
-
bioRxiv - Molecular Biology 2020Quote: ... All libraries and controls went through 13 PCR cycles using KAPA HiFi HotStart Ready Mix (KAPA Biosystems). PCR products were size-selected on a 1.8% agarose gel before loading on a Novaseq (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... The barcoded sequencing libraries were quantified by quantitative PCR using the KAPA Library Quantification Kit (KAPA Biosystems). Sequencing libraries were loaded on a NextSeq500 (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... probes were generated by PCR incorporation of DIG-11-dUTP into target sequences following manufacturer’s instructions (Roche). Chromosome 5-chromosome 7 translocation was detected using primers AB1028 and AB1029 amplifying a 180 bp region of chromosome 5 (Chr5 nt ...
-
bioRxiv - Cancer Biology 2022Quote: Immunoprecipitated chromatin has been analysed by q-PCR using the LightCycler 480 SYBR Green I Master (Roche) on a LightCycler® 96 Instrument or the Mesa Green qPCR MasterMix Plus for SYBR Assay (Eurogentec ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time PCR assays were performed using the LightCycler FastStart DNA Master PLUS SYBR Green kit (Roche) and a LightCycler PCR instrument (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... Southern blot probe for CAG-CATflox-AT2R mice was generated using PCR DIG probe synthesis kit (Roche) with primers GCC GAA TTC GCC GCC ACC ATG AAG GAC AAC TTC AGT TTT GCT GCC and GCA GGT AAT AAA AAA ATA TGC TTG CAA ACA TGT TCA G ...
-
bioRxiv - Neuroscience 2022Quote: ... and used as template for PCR using KAPA HiFi HotStart DNA Polymerase with 2X Master Mix (Roche) to amplify the target sequence in exon 4 of Nlgn3 using forward 5’ CCCCAGAAGCTAGCCATGGTCAC 3’ and reverse 5’ GACAGGACCTATAAAACTCAGCCAAG 3’ primers ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s instructions and real-time PCRs were performed on a LightCycler (Roche Diagnostics, France). No signal was detected in samples that did not undergo reverse transcription or in blank runs without cDNA ...
-
bioRxiv - Neuroscience 2022Quote: ... Thermal cycling was performed on a Real-Time PCR system Light Cycler 480 (Roche, Indianapolis, IN, USA) in 384-well plates ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were processed for DNA isolation using the High Pure PCR Template Preparation Kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplification with 9 – 12 cycles using the KAPA HiFi HotStart Uracil + DNA Polymerase (Roche/KAPA Biosystems) was performed according to suggested protocols ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplification with 9 – 12 cycles using the KAPA HiFi HotStart Uracil + DNA Polymerase (Roche/KAPA Biosystems) was performed according to suggested protocols ...
-
bioRxiv - Neuroscience 2022Quote: ... and quantified by using Qubit 2.0 Fluorometer as well as by quantitative PCR (KAPA Biosystems, Wilmington, US). The sequencing libraries were clustered on a flow cell ...
-
bioRxiv - Immunology 2022Quote: ... TCR or CAR plasmid pools were used as templates for PCR amplification (KAPA HiFi HotStart ReadyMix, Roche) to generate double-stranded DNA templates including truncated Cas9 target sequences (Nguyen et al. ...
-
bioRxiv - Physiology 2024Quote: ... Real-time PCR profiles were visualized using the commercially available FastStart Universal SYBR Green Mastermix (Roche, SUI) and Qiagen human Primer Assays (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative PCR was performed on a Roche LightCycler 480 using KAPA SYBR FAST qPCR MasterMix (Roche: KK4611).
-
bioRxiv - Neuroscience 2024Quote: ... whole transcriptome amplification by PCR was performed for 12 cycles using KAPA HiFi HotStart ReadyMix (Roche, 7958935001) with a PCR primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Neuroscience 2024Quote: ... Library cleanup was performed prior to and after PCR amplification using 0.8X Kapa Hyperpure beads (Roche 08963851001). PCR amplification was performed with the following parameters as described in the EpiCypher CUT&RUN kit ...
-
bioRxiv - Microbiology 2023Quote: The extraction of genomic DNA was performed using the High Pure PCR template preparation kit (Roche, Germany) as described previously.48 WGS of the isolates was carried out at the Biotechnology Platform ...
-
bioRxiv - Molecular Biology 2024Quote: Genomic DNA (gDNA) was isolated from mouse ear punch biopsies using the PCR Template Preparation kit (Roche). Targets was PCR amplified using Taq Polymerase (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... PCRs were carried out using KAPA HiFi HotStart DNA polymerase from KAPA Biosystems (KAPA Biosystems, Boston, USA). The resulting PCR products were purified using the DNA Gel Extraction Kit from New England Biolab (New England Biolab ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was carried out using the KAPA HiFi HotStart Ready Mix (Cat. No. 7958935001, Roche, Basel, Switzerland). The amplified products were purified using the QIAquick PCR purification kit and underwent size selection using 1.5% low-melt agarose gels and Gel DNA Recovery Kit (Cat ...