Labshake search
Citations for Roche :
2851 - 2900 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... and KAPA HiFi Polymerase MM or Phusion High-Fidelity PCR MasterMix (Kapa Biosystems, Wilmington, Massachusetts, US), Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2022Quote: ... We PCR amplified the oligo pool for 25 cycles using KAPA HiFi DNA polymerase (Roche, KK2103). We digested lentiCRISPRv2 plasmid (Addgene #52961 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and quantified using real-time PCR with an Illumina library quantification kit (KAPA Biosystems, Wilmington, MA). Uniquely barcoded samples were pooled in equimolar concentrations and sequenced (150 bp reads ...
-
bioRxiv - Microbiology 2019Quote: ... Gene copy numbers were determined using a LightCycler 480 real-time PCR system (Roche, Basel, CH). Individual reactions contained 1 × PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2019Quote: ... The libraries were PCR amplified with KAPA HiFi for 4-6 cycles (KAPA Biosystems, Boston, MA). The final libraries were purified with two 0.7x AMPureXP bead cleanups ...
-
bioRxiv - Plant Biology 2020Quote: ... and the PCR was performed with a LightCycler® 480 Instrument II (384-well; Roche Diagnostics) according to the manufacturer’s instructions on three biological replicates (each with 4 to 6 pooled inflorescences from individual plants) ...
-
bioRxiv - Cell Biology 2019Quote: ... qPCR reactions were performed on a LightCycler® 480 Real Time PCR System (Roche, Basel, Switzerland). Samples were analysed using the comparative CT method ...
-
bioRxiv - Developmental Biology 2019Quote: ... The resulting cDNA was subjected to real-time PCR analysis in a LightCycler 480 instrument (Roche) with either KAPA SYBR FAST for LightCycler 480 (Kapa Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... 10μL PCR grade water and 25 μL of KAPA© HiFi Hot Start ReadyMix (Roche, Switzerland). The following PCR cycling was used ...
-
bioRxiv - Physiology 2021Quote: ... and quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using SYBR green (Roche; #04913914001). Quantification of messenger RNA (mRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative PCR assays were performed in duplicate on the LightCycler 480 platform (Roche, Indianapolis, IN, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative PCR was performed in technical duplicates with FastStart Essential DNA Green Master Mix (Roche, 06402712001) and a LightCycler 96 instrument (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... The DIG-labeled probe was synthesized using the PCR DIG probe synthesis kit (11636090910, Roche, Switzerland) and the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... Emulsion PCR was performed using the GS FLX Titanium emPCR Kit Lib-L (Roche Applied Science) to enrich DNA library beads for the 454 GS-junior sequencers ...
-
bioRxiv - Pathology 2021Quote: DNA extraction and PCR were performed using Kapa mouse genotyping kit (Kapa Biosystems, Wilmington, MA, USA) according to the manufacturer protocol ...
-
bioRxiv - Genomics 2021Quote: ... The p415-CYC1-HIS3 plasmid was linearized by inverse PCR using KAPA HiFi polymerase (Kapa Biosystems) with primers F-p415-His and R-p415-HIS (oligonucleotide sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2021Quote: ... The sample was amplified through 30 PCR cycles with the KapaHiFi DNA polymerase enzyme (Kapa Biosystems). The library for nanopore sequencing was generated using the ONT’s Ligation Sequencing 1D kit (SQK-LSK108 ...
-
bioRxiv - Genomics 2019Quote: ... The qPCR was performed with KAPA HiFi HotStart Real-time PCR Master Mix (2X) (Kapa Biosystems) for 11 cycles following the recommended cycling protocol ...
-
bioRxiv - Genetics 2021Quote: ... The library PCR reactions for the bone samples utilized KAPA HiFi HotStart Uracil+ ReadyMix (Roche Sequencing) to accommodate for uracils present in the native DNA molecule from cytosine deamination ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time PCR reactions were performed on a LightCycler® 480 Instrument II (Roche Life Science) using Luna Universal qPCR Master Mix (NEB ...
-
bioRxiv - Genomics 2021Quote: ... the captured strands were process for library amplification by PCR using KAPA Uracil+ HiFi enzyme (Roche) and TrueSeq primers included in the kit ...
-
bioRxiv - Microbiology 2021Quote: The zomB gene was amplified by PCR from ATCC 700669 using KAPA HiFi HotStart ReadyMix (Roche) and primers zomBFW ...
-
bioRxiv - Cancer Biology 2021Quote: ... the Real-time PCR reaction was performed with 10uL FastStart SYBR Green Master Mix (Roche #04673492001), 2 uL of complementary DNA (cDNA) ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative PCR was performed using Kapa SYBR fast qPCR master mix (Kapa Biosystems, Woburn, MA, USA). The primer sequences for qPCR are GAPDH-fw ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Genetics 2021Quote: ... Quantitative PCR (qPCR) was performed using the KAPA SYBR Fast Universal Master Mix (Roche, Basel, Switzerland) in a Mx3000P real-time PCR instrument (Stratagene California ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PCRs were performed using KAPA SYBR FAST qPCR Master Mix Kit (Kapa Biosystems) on a LightCycler 480 Instrument II (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplification was analysed by the second-derivative maximum algorithm (Light Cycler 480 Sw 1.5; Roche), and expression of the gene of interest was normalized to that of the housekeeping gene Actb (beta-actin) ...
-
bioRxiv - Immunology 2021Quote: Real-time PCR assays for the detection of mRNAs were performed using Light Cycler System (Roche) and 384-Well Reaction Plates (Roche) ...
-
bioRxiv - Genomics 2021Quote: ... cDNA was then amplified by adding 50 ul 2X Kapa HIFI PCR ReadyMix (Kapa Biosystems, KK2602), 10 ul of the 10 uM DRUG-seq PCR primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... Purified libraries were normalized by quantitative PCR (qPCR) using the KAPA Library Quantification Kit (KAPA Biosystems) and diluted to a final concentration of 10 nM ...
-
bioRxiv - Molecular Biology 2022Quote: ... The purified pool was quantified by real-time PCR with the Kapa Biosystems Quantification Kit (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: DNA from liver and cell pellets was isolated using High Pure PCR Template Preparation Kit (Roche). DNA concentrations were measured by Nanodrop 2000c Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Real-time quantitative PCR (qPCR) was performed using the LightCycler 480 SYBR Green I Master (Roche) or the Mesa Green qPCR MasterMix Plus for SYBR Assay (Eurogentec ...
-
bioRxiv - Genomics 2022Quote: ... quantitative PCR was performed using the LightCycler® 480 SYBR Green I Master (Roche CAT. 04887352001) and the standard amplification protocol with 45 cycles in a multi-well PCR plate 384 ...
-
bioRxiv - Cell Biology 2022Quote: ... Expression levels of different genes were determined by qRT-PCR using SYBR Green Supermix (Roche, Germany), using the ABI Q5 Real Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: ... qRT-PCR was conducted with the LightCycler 480 SYBR Green I Master kit (Cat. 04887352001, Roche). Primers used for qRT-PCR are listed in Supplementary Table 2 ...
-
bioRxiv - Genomics 2022Quote: ... Quantitative PCR was performed using LightCycler 480 SYBR Green I Master reaction mix (Roche, Rotkreuz, Switzerland) and the primers listed in Table 5 ...
-
RTEL-1 and DNA polymerase theta promote subtelomeric DNA synthesis and telomere fusion in C. elegansbioRxiv - Genetics 2022Quote: ... Probe was generated using the PCR DIG probe synthesis reaction kit (Roche cat# 11636090910, Basel, Switzerland). Tel2 (GAATAATGAGAATTTTCAGGC ...
-
bioRxiv - Microbiology 2022Quote: ... The sgRNA DNA templates were synthesized via fill-in PCR using KAPA HiFi DNA Polymerase (Roche) and sgRNA-specific and universal primers (Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Real-time PCR reactions were performed on a LightCycler® 480 Instrument II (Roche Life Science) using Luna Universal qPCR Master Mix (NEB ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR analyses were conducted on a LightCycler® 96 System (Roche Diagnostics GmbH, Mannheim, Germany) using the SYBR Green I Master Mix (Vazyme ...
-
bioRxiv - Plant Biology 2022Quote: ... The reactions were performed in a LightCycler® 96 Real-Time PCR system (Roche Life Science). Samples were subjected to ten minutes of pre-incubation at 95°C ...
-
bioRxiv - Plant Biology 2022Quote: ... The purified PCR products were used to construct libraries by the Kapa DNA Hyper Kit (Roche) together with TruSeq DNA UD indexes for Illumina (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gene expression was analyzed by quantitative PCR (qPCR) in 384-well plates using the LightCycler480 (Roche). For each tissue ...
-
bioRxiv - Neuroscience 2022Quote: qRT-PCR amplification was performed with a LightCycler 480 (Roche Life Science, Welwyn Garden City, UK) using 45 cycles (initial heat denaturation 95°C/10min ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quantitative PCRs were carried out in triplicate using SYBR Green I Master Mix (S-7563, Roche) on a LightCycler 480 system (Roche) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 10 ng analysed by qPCR using a Light Cycler 480 real-time PCR system (Roche) to quantify the proportion of each tagged strain.
-
bioRxiv - Cell Biology 2024Quote: ... was used to perform qPCR on a Lightcycler 96 Real-Time PCR System (Roche, Basel, Switzerland). The relative transcript abundance was normalized to Ef1α expression as the reference gene control ...
-
bioRxiv - Neuroscience 2024Quote: ... qRT-PCR was performed using the Thunderbird SYBR qPCR Mix (Toyobo) and Light Cycler 480 (Roche) following the standard protocol for absolute quantification (see Supplementary Table S2 for primer sequences) ...