Labshake search
Citations for Roche :
3001 - 3050 of 3182 citations for Dengue Virus Serotype 4 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The stained cells were further labelled by TUNEL (TdT-mediated dUTP-X nick end labeling) with an In-Situ Cell Detection Kit (TMR red) from Roche (12156792910). Fluorescent images were collected on a Zeiss Automatic stage microscope with Zen blue software ...
-
bioRxiv - Cell Biology 2022Quote: Murine cells or aortic tissue were lysed in RIPA buffer containing complete protease inhibitor and phosphoSTOP phosphatase cocktails (Roche Applied Science). Lysate was centrifuged at 10,000 g for 10 min at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmid was transfected into Neuro2a cells and clonal lines selected by incubation with Hygromycin (300 mg/ml, Roche (Nutley, NJ)) ...
-
bioRxiv - Biochemistry 2022Quote: ... the cells were scraped on ice in 500 µL of ice-cold PBS containing cOmplete™ Protease Inhibitor Cocktail EDTA-free (Roche) and Phosphatase Inhibitor Cocktails 1 & 2 (Sigma) ...
-
bioRxiv - Biochemistry 2022Quote: ... the cells were scraped on ice in 500 µL of ice-cold PBS containing cOmplete™ Protease Inhibitor Cocktail EDTA-free (Roche) and PhosStop (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... Phoenix-Amphoteric packaging cells were transfected with MP71 constructs in combination with pVSV using FUGENE HD transfection reagent (Roche Molecular Biochemical) to obtain retroviral supernatants ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cell Biology 2022Quote: TUNEL assay was performed on N153S and WT lumbar disc tissue sections using an in situ cell death detection kit (Roche Diagnostic). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... AML blast cells were incubated in 1 ml of ice-cold 0.1 M Na2CO3 containing complete protease inhibitor (Roche, Penzberg, Germany) and phosphatase inhibitor PhosSTOP (Roche ...
-
bioRxiv - Biochemistry 2021Quote: Transfection of plasmid DNA was conducted in 293T cells using Lipofectamine 3000 (Life Technology) and X-tremeGENE™ HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 pseudotyped virus was generated by co-transfection of the pCAGGS-S with the viral packaging plasmid psPAX2 and pLenti-EGFP/luciferase-expressing plasmid as a proportion of 1:1:1 into HEK293T cells using the X-tremeGENE HP DNA transfection reagent (Roche, 06366546001) according to the manufacturer′s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and washed once in cell lysis buffer supplemented with 20U of human placental RNase inhibitor and cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) prior to processing lysates ...
-
bioRxiv - Neuroscience 2021Quote: Cytotoxicity in primary and cell line cultures was assessed using the cytotoxicity Lactate DeHydrogenase (LDH) detection kit according to the manufacturer’s instructions (Roche, Basel, Switzerland). The culture medium was centrifuged at 500xg for 5min to pellet cell debris before used in the experiments.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Viral supernatants were prepared by transfecting 293T cells with GFP- or ABCG-targeting shRNAs encoded in pLKO.1 vectors using X-tremeGENE 360 transfection reagent (Roche, Germany) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The resultant plasmids were transfected into cultured cells susceptible to the original viruses using X-tremeGENE™ HP DNA transfection reagent (Roche). For BmNPV ...
-
bioRxiv - Genetics 2020Quote: N-terminal HA-tagged PRUNE1 overexpression constructs were transfected into PRUNE1 non-expressing HEK293 cells using X-tremeGENE HP DNA (Roche; 06366236001) transfection reagent ...
-
bioRxiv - Biochemistry 2019Quote: ... The transfection of GFP-RNase H1 R-loop-binding domain (GFP-HB) for R-loop detection into HEK293 cells was performed with the FuGENE Transfection reagent (Roche, E269A).
-
bioRxiv - Molecular Biology 2019Quote: ... A qPCR analysis of mRNA expression from FD cells samples were conducted using KAPA SYBR Fast qPCR master mix (Kapa Biosystems) in a StepOne plus thermocycler PCR machine (Applied Biosystems ...
-
bioRxiv - Immunology 2019Quote: ... Cells were lysed (10mM Tris-HCl [pH 8], 0.25% Triton X-100, 10mM EDTA, 100mM NaCl, Roche 1X Complete Protease Inhibitor) and nuclei were collected and re-suspended in 300μl SDS lysis buffer (1% SDS ...
-
bioRxiv - Developmental Biology 2020Quote: A 257 bp digoxigenin-labeled RNA probe was generated from a region spanning exons 1-3 of cat Dkk4 using a PCR-based template (cDNA from Stage 16 cat embryonic epidermal cells; CCCTGAGTGTTCTGGTTTT, AATATTGGGGTTGCATCTTCC) and in vitro transcription (Roche Diagnostics). 10 μ M paraffin-embedded sections were deparaffinized with xylenes and antigen retrieval using 0.01 M citrate buffer ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The reagents were added in the dark according to the instructions of the In Situ Cell Death Detection Kit (Roche, US). Images were acquired under a fluorescence microscope.
-
bioRxiv - Neuroscience 2020Quote: ... After centrifugation, cells were lysed (750 mM NaCl, 10 mM Tris, 1 mM EDTA pH 7.6, protease inhibitor (Roche, Mannheim, Germany)) ...
-
bioRxiv - Cell Biology 2019Quote: Cells were lysed in Tris-buffered saline (TBS) supplemented with 1% Triton X-100 and protease/phosphatase inhibitor cocktails (Roche Diagnostics), the insoluble material was cleared by centrifugation for 10 min at 20,000 × g ...
-
bioRxiv - Genomics 2019Quote: ... after cells were lysed with Farnham Lysis Buffer (5 mM HEPES pH 8.0, 85 mM KCl, 0.5% IGEPAL, Roche Protease Inhibitor Cocktail), and nuclei were resuspended in RIPA buffer (1x PBS ...
-
bioRxiv - Genetics 2021Quote: ... and the internal control vector TK (25 ng per well for 48-well plate) were co-transfected into the cells by using the X-tremeGene HP DNA transfection reagent (ROCHE, 6366236001). The transfected HEK293T cells were harvested in 65 μL passive lysis buffer (Promega ...
-
bioRxiv - Genetics 2020Quote: ... 100,000 cells were washed twice (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1x Roche cOmplete protease inhibitors) and attached to 10 ConA-coated magnetic beads (Bangs Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: The terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was used for detecting cell apoptosis according to the manufacturer’s instructions (Roche Diagnostics, USA). In brief ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were harvested and resuspended in purification buffer (supplemented with Complete Protease Inhibitor Cocktail tablet as per Roche Applied Science instructions), and lysed by sonication ...
-
bioRxiv - Cell Biology 2020Quote: ... Fusion was carried out by resuspending the mixed cell pellet slowly in 1 mL of 50% PEG 1500 (Roche, Basel, Switzerland) at 37°C over the course of 1 minute and incubated for a further 1 minute at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... cell pellets were resuspended in a lysis buffer (see below) supplemented with 1x protease inhibitor cocktail (Roche cOmplete Protease Inhibitor Cocktail) and lysed using a Dounce homogenizer (20 strokes with loose plunger followed by 20 strokes tight plunger) ...
-
bioRxiv - Developmental Biology 2021Quote: Cos-1 cells were grown in DMEM supplemented with 10% heat inactivated FCS and transfected with Fugene HD (Roche Applied Science) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... 3.75 μg of psPAX2 and 1.25 μg of pVSVG) were transfected into LentiX-293T cells using 20 μl of X-tremeGENE™ HP DNA Transfection Reagent (Roche) at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mg of plasmid DNA was transfected into HMEC P5 was transduced into Phoenix packaging cells using Fugene (Roche, Basel, Switzerland). Viral supernatant was harvested 48 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA expressing vectors along with retroviral packaging vectors Gag-Pol and VSG-G were transfected into HEK293T cells using X-tremeGENE 9 DNA Transfection reagent (Roche #6364787001). Virus-containing supernatant was collected 48 hours after transfected and passed through a 0.45μm filter ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA expressing vectors along with lentiviral packaging vectors Delta-VPR and VSV-G were transfected into HEK293T cells using X-tremeGENE 9 DNA Transfection reagent (Roche #6364787001). cDNA expressing vectors along with retroviral packaging vectors Gag-Pol and VSG-G were transfected into HEK293T cells using X-tremeGENE 9 DNA Transfection reagent (Roche #6364787001) ...
-
bioRxiv - Biochemistry 2022Quote: ... coli cells were lysed by sonication on ice in PBS pH 7.4 with protease inhibitors (cOmplete, EDTA-free, Roche Applied Science). The protein was purified over Glutathione Sepharose 4 Fast Flow (GE Healthcare ...
-
bioRxiv - Bioengineering 2022Quote: ... the cells were rinsed with PBS and incubated with 5% (v/v) normal donkey serum and 1% (w/v) BSA (Roche, 10.7350.86001) in PBS for 1 hour at room temperature to block the non-specific antibody binding ...
-
bioRxiv - Bioengineering 2022Quote: ... Encapsulated or adherent cells were plated in a 96 well plate for 24 or 48h when WST-1 reagent (Roche, Switzerland) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... IFNγ-R2-eGFP plasmid was transfected in HeLa or Caco-2 cells with X-tremeGENE HP DNA transfection reagent (Roche, 6366236001) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Tissues or cells were lysed in NP-40 lysis buffer (Beyotime P0013F) supplemented with protease inhibitor cocktail (complete Mini, Roche 04693124001), phosphatase inhibitor cocktail (PhosSTOP ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... cells were maintained in growing media (DMEM + Glutamax, 10% FBS, pen/strep 5ml) supplemented with 0.8mg/ml G418 (Roche, G418-RO) for maintenance or removed for exposure to chemicals ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pellet cells were then resuspended in 400 μL of lysis buffer (PBS 1x supplemented with Roche protease inhibitor and benzonase). Cells were lysed by sonication (30% Amp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The recombinant plasmid pcDNA3.1-Orm2 was transiently transfected into LO2 cells for 48 h with X-treme GENETMHP DNA Transfection Reagent (Roche, Basel, Switzerland).
-
bioRxiv - Microbiology 2022Quote: ... cell pellet was resuspended in prechilled buffer A (20 mM Tris/HCl, pH: 8) supplemented with cOmplete™ protease inhibitor (Roche) and 5 mM EDTA ...
-
bioRxiv - Molecular Biology 2024Quote: ... treated with λPPase or that purified from Calyculin A-treated cells was subjected to proteolytic digestion with 0.01 ng/µl trypsin (Roche, sequencing grade) for 0 ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were washed three times with TBS-T and were incubated with a TUNEL reaction mixture (In Situ Cell Death Detection Kit, TMR red, Roche 12156792910) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then resuspended in 10 ml of cold PBS and incubated with cOmplete mini EDTA-free protease inhibitor (Roche, 11836170001) for 30 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... and a sgRNA preceded by a rrk1 leader and followed by a Hammerhead Ribozyme as described in [17] was digested and prepared for gap repair as follows: the vector pJB166 was purified from DH5α bacterial cells using the Genopure plasmid midi kit (Roche, 03143414001) and diluted to 1 μg/μL ...
-
bioRxiv - Cancer Biology 2023Quote: ... unconcentrated cell culture supernatants were incubated with a rabbit monoclonal anti-glycodelin antibody (clone 12C9, kindly provided by ROCHE, Penzberg, Germany) for 1 h at room temperature prior to incubation with immune cells ...
-
bioRxiv - Genomics 2023Quote: hTERT RPE-1 cells at 70% confluence were harvested by trypsinization after 2-hour treatment with colcemid (100 ng/ml, Roche 10295892001) to arrest cells in mitosis ...