Labshake search
Citations for Roche :
701 - 750 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... all tissue sections were stained with DAPI (4’, 6-Diamidine-2’-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). Images were taken with a confocal microscope from Zeiss (LSM 880 Airyscan).
-
bioRxiv - Molecular Biology 2024Quote: ... and purified with quick spin RNA columns (Roche, Indianapolis, IN). Biotin-labeled RNA or unbiotinylated RNAs was dissolved in RNA structure buffer (10 mM Tris ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1× Complete Protease Inhibitor Cocktail (05056489001, Roche).
-
bioRxiv - Molecular Biology 2024Quote: ... Biotinylated RNAs were transcribed in vitro with Biotin-RNA Labeling Mix (Roche, Indianapolis, IN) and purified with quick spin RNA columns (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... GFP-tagged Myh was isolated from cell lysate using Dynabeads Protein G (Thermo 10004D) and GFP-tag Antibody (Roche #11814460001). IP and input were boiled in 5xLaemmli Buffer and separated on an SDS-PAGE (8-16% ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries for high throughput sequencing were made by PCR using KAPA HiFi HS ReadyMix (Roche) from genomic DNA (Qiagen blood and tissue kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... To detect for DNA containing complementary sequences on membrane-bound DNA a α-32P-dCTP-labelled probe spanning the region of 37-611 nts on human mtDNA was synthesized using High Prime DNA Labeling Kit (Roche). After pre-hybridizing the membrane with Church’s buffer (250 mM NaPi pH 7.2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was amplified using the 2X KAPA Taq ReadyMix PCR Kit (KAPA Biosystems, now Roche Sequencing, Indianapolis, IN) for 35 cycles using an annealing temperature of 64°C ...
-
bioRxiv - Neuroscience 2024Quote: ... BSA (2mg/ml, Roche), and 1X SSC ...
-
bioRxiv - Neuroscience 2024Quote: ... Triton 0.01X) supplemented with a protease inhibitor cocktail (#11873580001, Roche Diagnostic). Samples were then sonicated (2 ×3 s ...
-
bioRxiv - Neuroscience 2024Quote: ... alkaline phosphatase-conjugated antibody (Roche). The sections were subsequently rinsed and incubated in the dark with a NBT/BCIP solution (Nitroblue tetrazolium chloride/ 5-bromo-4chloro-3-indyl-phosphate ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Neuroscience 2024Quote: ... The sections were subsequently rinsed and incubated in the dark with a NBT/BCIP solution (Nitroblue tetrazolium chloride/ 5-bromo-4chloro-3-indyl-phosphate; Roche) until the staining appeared (overnight or up to 48 h) ...
-
bioRxiv - Microbiology 2024Quote: ... The membranes were exposed to chemiluminescence detection films (Roche Diagnistics, Rotkreuz, Switzerland). Detection of actin served as loading control for the lysate.
-
bioRxiv - Microbiology 2024Quote: RNAs were extracted 48 hours after RNP transfection using the High Pure RNA Isolation Kit (Roche) according to instructions of the manufacturer ...
-
bioRxiv - Microbiology 2024Quote: ... (4) we used KAPA HiFi master mix (Roche, 07958935001) and 19 cycles of PCR.
-
bioRxiv - Microbiology 2024Quote: ... in 384-well plates (Roche). The total reaction volume per well was 3 µl ...
-
bioRxiv - Microbiology 2024Quote: ... utilizing LightCycler® 480 SYBR Green I Master Mix (Roche) in 384-well plates (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... The gDNA levels corresponding to the viral genes and the housekeeping wasp gene (elongation factor (ELF-1)) were determined using the LightCycler 480 System (Roche). The cycling conditions involved heating at 95°C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... The cells were lysed by adding Lysozyme (MP-Biomedicals) and DNase I (Roche Applied Sciences) and incubating them on ice for 30 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... The RT-qPCR was carried out using SYBR green master mix (Roche Applied Science) in a QuantiFast light cycler (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems, Wilmington, MA), 0.3 mM of each primer and 1 µL of DNA template (20 ng µL-1) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10µl of ECM degrading enzyme Dispase-ii (Roche) was applied to the exposed mesodermal surface for 5 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and 100 ng were used for paired-end Illumina sequencing library preparation using the KAPA HyperPlus Library Preparation Kit (Roche) and the KAPA Unique Dual-Indexed Adapater Kit (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... and the KAPA Unique Dual-Indexed Adapater Kit (Roche), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... the KAPA HiFi HotStart Readymix (KAPA Biosystems, Roche, 0.5 mM MgCl2) was used in 25 µL reactions with 0.4 mM of each primer and 1 µL template ...
-
bioRxiv - Microbiology 2024Quote: ... 0.75 µL of dNTP (10 mM each, Roche) and 2.65 µL of nuclease-free water ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Microbiology 2024Quote: ... the KAPA HiFi HotStart Readymix (KAPA Biosystems, Roche, 0.5 mM MgCl2) was used in 25 µL reactions with 0.4 mM of each primer and 1 µL template ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1x PhosSTOP phosphatase inhibitor (Roche) for 30 minutes at 4°C with gentle agitation ...
-
bioRxiv - Microbiology 2024Quote: ... and lysed by incubation with nondenaturing lysis buffer (300 mM NaCl, 100 mM Tris-HCl [pH 7.4], 2% Triton X-100, and 1×EDTA-free protease inhibitor cocktail [Roche Complete]) for 30 min on ice ...
-
bioRxiv - Cell Biology 2024Quote: ... 40% glycerol and 0.04% bromophenol blue) containing the protease inhibitor cocktail (Roche, 04693132001) and the phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... and the phosphatase inhibitor cocktail (Roche, 04906837001). For separation of soluble and insoluble proteins ...
-
bioRxiv - Cell Biology 2024Quote: ... 2μg ⍺-GFP (Roche) or 0.05 μg ⍺-FLAG (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... interleukin-2 (IL-2; specific activity 10 U/ng) at concentration of 20 ng/mL (Roche) and phytohemagglutinin (PHA ...
-
bioRxiv - Microbiology 2024Quote: ... on the Light Cycler 480 II instrument (Roche Diagnostics).
-
bioRxiv - Microbiology 2024Quote: ... qPCR reactions were performed in 384-well plates (LightCycler 480 Multiwell Plates 384, white, Roche Diagnostics) on the Light Cycler 480 II instrument (Roche Diagnostics).
-
bioRxiv - Microbiology 2024Quote: ... For qPCR LightCycler 480 SYBR Green I Master mix (Roche Diagnostics, Vilvoorde, Belgium) was used in final reaction of 15 μL ...
-
bioRxiv - Microbiology 2024Quote: ... Transposon junctions were amplified with oligos pJZ_Fwd_RND1 and olj376 using 500 ng DNA and KAPA HiFi Hotstart Mix (Kapa Biosystems, #KK2602). Reactions were stopped at the inflection point of amplification (6-14 cycles) ...
-
bioRxiv - Microbiology 2024Quote: ... 150 mM NaCl) supplemented with EDTA-free protease inhibitor (Roche) and clarified by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... in the presence of RNaseA (50 μg/ml; Roche) and incubated for 2 h with gentle rocking at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... the sections were incubated with anti-DIG AP conjugate (Roche; 1:2000) with G-block (diluted 1/50 ...
-
bioRxiv - Microbiology 2024Quote: ... 2.5 μL of 5 μM reverse primer and 10 μL of KAPA SYBR FAST (KAPA Biosystems). The qRT-PCR was done in CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared with the KAPA Stranded RNA-Seq Library Preparation Kit (Kapa Biosystems) and assessed using fragment analyzer (Agilent Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended in 150 μL of resuspension buffer (150 mM NaCl, 50 mM Tris-HCl, supplemented with cOmplete EDTA-free protease inhibitor cocktail [Roche], pH 7.4). For protein identification ...
-
Tryptophan Metabolites And Their Predicted Microbial Sources In Fecal Samples Of Healthy IndividualsbioRxiv - Microbiology 2024Quote: ... Libraries were amplified for 13 PCR cycles in 50 μl reactions containing 150 pmol of P1.1 (5’-AATGATACGGCGACCACCGAGA) and P3 (5’-CAAGCAGAAGACGGCATACGAGA) primer and Kapa HiFi HotStart Library Amplification kit (Cat# kk2612, Roche Sequencing and Life Science). Library quantification and size estimation were performed using a Fragment Analyzer (Agilent Technologies ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... transfection was performed using X-tremeGene HP Transfection Reagent kit (Roche) to introduce 500ng of Halo-RaOp DNA using EBM-2 culture media without antibiotic ...