Labshake search
Citations for Roche :
651 - 700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Cell pellets were resuspended in 1x PLB (10x PLB: 1 M KCl, 50 mM MgCl2, 100 mM HEPES-NaOH pH 7.5, 5% NP-40, Roche protease and phosphatase inhibitors (1 tab each per 10 mL) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-p53 (#05278775001, Roche), anti-MDM2 (#113-0230 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The beads were magnetically separated as above and pooled eluate added to PCR strip tubes containing 2X KAPA HiFi HotStart ReadyMix (Roche, Cat# 07958935001) and 2 mM each of P5 (AATGATACGGCGACCACCGAGATCTACA*C ...
-
bioRxiv - Cancer Biology 2024Quote: ... and DNase I (0.1 mg/ml, Roche, 11284932001) in RPMI for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time qPCR was performed using KAPA SYBR FAST mix (Kapa Biosystems, #KK4660) with a StepOne real-time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Light Cycler® 96 Real-Time PCR System (Roche) with LightCycler® 480 SYBR Green I Master (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... and PhosSTOP tablet (Roche, 4906837001). 20 µg protein was loaded on a 4-12% Bis-Tris Bolt gel (Life Technologies GmbH ...
-
bioRxiv - Cell Biology 2024Quote: RNA extraction from cultured cells has been performed using the High Pure RNA Isolation Kit (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... MycTrap beads were pre-incubated with yeast tRNA (Roche, Switzerland) to block non-specific RNA binding in 0.15M KCl Wash Buffer supplemented with 0.5mM DTT and 40U/ml RiboLock RNase inhibitor (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 100μg/ml RNase A (10109169001 - Roche) in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... and protease inhibitor cocktail from Roche) and lysed for 30 minutes at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... testes were homogenized in 1x RIPA buffer containing protease inhibitor cocktail (cOmplete Mini, EDTA-free, Roche), centrifuged at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 1X complete protease inhibitor and 1X PhosSTOP phosphatase inhibitor (Roche). Genomic DNA in the lysate was sheared using 27G syringe needles ...
-
bioRxiv - Cell Biology 2024Quote: ... 10ul/ml cOmplete™ Protease Inhibitor Cocktail (Roche, SKU 11836170001), phosphatase inhibitor cocktail mix (10 mM tetrasodium pyrophosphate ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral vectors expressing sgRNAs were transfected into HEK293T cells with lentiviral packaging vectors CMV VSV-G and psPAX2 using XtremeGene 9 transfection reagent (Roche). After 24 h ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with protease inhibitors (cOmpleteMini, Roche). Protein concentration was determined using a Pierce BCA protein assay kit (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 tablet EDTA-free protease inhibitor (Roche, #11836170001). After pellets were fully resuspended ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with protease inhibitors (cOmpleteMini, Roche). Lysates were then transferred to 1.5ml Eppendorf tubes and vortexed vigorously for 30s prior to centrifugation at 21,000g for 10 minutes at 2°C ...
-
bioRxiv - Cell Biology 2024Quote: ... was transfected into U2OS cells using JetPRIME transfection reagent (Roche Applied Science, Mannheim, Germany), according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... cells were lysed in cOmplete Protease Inhibitor Cocktail (Roche) containing RIPA buffer.
-
bioRxiv - Cell Biology 2024Quote: ... for real-time quantitative PCR (RT-qPCR) in a LightCycler®480 System (Roche). The following primers were used for determination of intracellular ZIKV genomes (fwd 5’ agatcccggctgaaacactg 3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein pellets were suspended in in cOmplete Protease Inhibitor Cocktail (Roche) containing radio-immunoprecipitation assay (RIPA ...
-
bioRxiv - Cell Biology 2024Quote: Cell proliferation was measured using WST-1 (water-soluble tetrazolium) assay (Roche, Cat # 501003295) according to standard manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... and quantitative PCR (KAPA Biosystems). Barcoded libraries were then pooled and sequenced on the HiSeq2000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... Sample cDNA and library quality controls were performed using the Agilent 4200 TapeStation instrument and quantified by qPCR (Kapa Biosystems/Roche). Libraries were sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... sEVs lysis was performed with cOmplete™ Lysis-M buffer (Roche Diagnostics GmbH, Mannheim, Germany), 10 µg of sEVs separated by SDS-PAGE gels were transferred to polyvinylidene difluoride membrane (PVDF ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were constructed using the KAPA mRNA HyperPrep Kit (KAPA Biosystems). Library quality and concentration were checked using the D5000 Screen Tape (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... Sample cDNA and library quality controls were performed using the Agilent 4200 TapeStation instrument and quantified by qPCR (Kapa Biosystems/Roche). Libraries were sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 µg/mL DNase I (Roche, #10104159001), 20 µg/mL RNase A (QIAGEN ...
-
bioRxiv - Cell Biology 2024Quote: ... and laminin (Roche, 11243217001) at approximately 1–2 ×106 cells/cm2 ...
-
bioRxiv - Cell Biology 2024Quote: ... with the LightCycler96 software (Roche). Gapdh was used as a housekeeping gene ...
-
bioRxiv - Cell Biology 2024Quote: ... Gene expression levels were quantified by Reverse Transcription quantitative polymerase chain reaction (RT–qPCR) using the LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland). Cycling parameters were set at (i ...
-
bioRxiv - Cell Biology 2024Quote: ... The second digestion step with collagenase/ dispase (Roche) is performed again first for 30 min at 4°C and then for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: SYBR Green I dye (Roche, Mannheim, Germany)
-
bioRxiv - Cell Biology 2024Quote: ... A total of 500 ng of RNA were then retrotranscribed using the Transcriptor First Strand cDNA Synthesis kit (Roche LifeScience) as previously described (Montañés et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... supernatants were harvested and purified using His-Tag purification resin (Roche, cOmpelteTM, Cat No.5893682001), followed by size-exclusion chromatography in 20 M Hepes or Tris pH 8 ...
-
bioRxiv - Cell Biology 2024Quote: ... and subsequently transfected without (Mock) or with ultrapure LPS (10 μg/ml) into the cytosol with DOTAP Liposomal Transfection Reagent (Roche) for 4 hours.
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.5 mg/mL DNase I (Roche, Cat # 11284932001). The reaction was halted by adding 1 μL of 0.5M EDTA (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were labeled for translation by anti-HA antibodies (12CA5, Roche) and with JF646 HaloTag ligand for mRNAs.
-
bioRxiv - Cancer Biology 2024Quote: ... and DAB staining was detected using the UltraView Universal DAB Detection Kit or the OptiView DAB IHC Detection Kit (all from Roche). The following antibodies were used ...
-
bioRxiv - Cancer Biology 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on a lane of a HiSeq flowcell ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-seq libraries were prepared using 500 ng of total RNA by using KAPA stranded RNA-seq kit for Illumina (Roche) as per manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 0.1% SDS) supplemented with proteinase inhibitor cocktail (11873580001, Roche, Basel, Switzerland) and phosphatase inhibitor (04906837001 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and phosphatase inhibitor (04906837001, Roche). Cell lysates were centrifuged at 14,000 x g for 15 min at 4°C and supernatants were collected ...
-
bioRxiv - Molecular Biology 2024Quote: Harvested cell pellets were lysed in 1xRIPA buffer supplemented with 1x EDTA-free cOmplete protease inhibitor (Roche) and 1x PhosphoSTOP phosphatase inhibitor (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1x PhosphoSTOP phosphatase inhibitor (Roche) for 30 minutes on ice with two rounds of 15 second vortexing ...
-
bioRxiv - Molecular Biology 2024Quote: ... and RNA was released from the membrane using Proteinase K (Roche, 03115828001). RNA was purified using neutral phenol/chloroform/isoamylalcohol (Ambion ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM MgCl2 (Roche Diagnostics), 0.3 µM of each primer (RB1_80F and RB1_235R ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500,000 HUVEC were washed with CUT&RUN wash buffer (20 mM HEPES pH 7.9, 150 mM NaCl, 500 nM spermidine, 1X Roche Protein Inhibitor Cocktail) at RT ...