Labshake search
Citations for Roche :
501 - 550 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The cells were pelleted by centrifugation (750 x g, 2 min, 4 °C) and resuspended in 50 μl vPBS containing EDTA-free protease inhibitor (Roche). The cells were fixed by addition of 0.5 ml ice-cold fixation solution (4% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... The cytoskeletal pellet was resuspended in 1 ml vPBS containing EDTA-free protease inhibitors (Roche) and centrifuged again (3,400 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with fresh 0,51mM DTT and 1× protease inhibitor mixture Complete (Roche)) ...
-
bioRxiv - Cell Biology 2024Quote: ... Nuclear pellet was then resuspended in RIPA buffer (1X PBS, 1% NP40, 0.5% Na-deoxycholate, 0.1% SDS, supplemented with 1× protease inhibitor mixture Complete (Roche)) and chromatin was sheared to a range of 200-500bp by using a Bioruptor instrument (Diagenode ...
-
bioRxiv - Developmental Biology 2024Quote: ... DIG-labeled probes were prepared using a DIG RNA labeling mixture (Roche) and the T7 (antisense probe ...
-
bioRxiv - Developmental Biology 2024Quote: Reactions containing FastStart Universal SYBR Green Master (Rox) (Roche) and the appropriate cDNA and primers were run in a 7500 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% Tween-20] and maintained for 2 hours in 2% blocking reagent (11096176001, Roche) in TNT ...
-
bioRxiv - Cancer Biology 2024Quote: ... and a protease inhibitor cocktail (Roche Pharmaceuticals). Proteins were separated by SDS-PAGE (Bio-Rad Laboratories) ...
-
bioRxiv - Cancer Biology 2024Quote: HEK293T cells were transiently transfected using Fugene reagent (Roche, Indianapolis, IN, USA) with pCMV-GFP/Luc plasmid (kindly provided by Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were quantified using the KAPA Library Quanitification Kits - Complete kit (Universal) (Kapa Biosystems). Average size fragment was determined using a LabChip GXII (PerkinElmer ...
-
bioRxiv - Cell Biology 2024Quote: Aortas were digested in Liberase TM (Roche) and passed through a cell strainer (40 µm ...
-
bioRxiv - Cell Biology 2024Quote: ... 15% glycerol) supplemented with protease inhibitors (1x Complete® EDTA-free (Roche, Cat. # C7698), 1 mM PMSF ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with protease inhibitors (1x Complete® EDTA-free (Roche, Cat. # C7698), 1 mM PMSF ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 mM NaF) supplemented with protease inhibitors (1x Complete® EDTA-free (Roche, Cat. # C7698), 1 mM PMSF ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% Triton X-100) supplemented with protease inhibitors (1x Complete® EDTA-free (Roche, Cat. # C7698), 1 mM PMSF ...
-
bioRxiv - Cancer Biology 2024Quote: Libraries were generated using the KAPA HyperPrep kit (Roche) following manufacturer’s instructions and captured with KAPA HyperExome following manufacturer’s instructions (KAPA HyperCap workflow v3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were amplified with KAPA HiFi HotStart Ready Mix (Roche, USA) and bead purified by AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2024Quote: ... Captured libraries were amplified with KAPA HiFi HotStart Ready Mix (Roche, USA) and purified with AMPure XP beads ...
-
bioRxiv - Cancer Biology 2024Quote: ... with the LightCycler 480 Probes Master Kit (Roche) and Taqman probes (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mM EDTA) supplemented with a protease inhibitor cocktail (Complete, Roche Applied Science, #11836153001) and phosphatase inhibitors (PhosSTOP Sigma #04906837001) ...
-
bioRxiv - Cancer Biology 2024Quote: ... qPCR for COLCA2 (OCA-T2) was performed using the LightCycler 480 (Roche) with the LightCycler 480 Probes Master Kit (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... with the following modifications: 1 x PhosSTOP (Roche, 4906845001) was included in all solutions up to and including the primary antibody incubation ...
-
bioRxiv - Cancer Biology 2024Quote: ... following manufacturer’s instructions and captured with KAPA HyperExome following manufacturer’s instructions (KAPA HyperCap workflow v3, Roche). Sequencing of paired tumor and normal libraries was performed on Illumina HiSeqX or NovaSeq6000 (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNAse1 50 U/mL (Roche, Indianapolis, IN, USA); Hank’s balanced salt solution (HBSS ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1.0% w/v NP-40) supplemented with cOmplete ULTRA EDTA-free protease inhibitor cocktail (#05892953001, Roche). Samples were homogenized and centrifuged at 20,000 ×g ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells were pelleted by centrifugation (750 x g, 2 min, RT) and washed in 4 ml vPBS containing EDTA-free protease inhibitor (Roche). The washed cells were again pelleted by centrifugation (750 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... and the cell pellet was gently resuspended in 1 ml ice-cold vPBS containing EDTA-free protease inhibitor (Roche). The cells were again pelleted by centrifugation (1000 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... or ice-cold 8% (v/v) paraformaldehyde solution/ 0.2% (v/v) glutaraldehyde in vPBS containing EDTA-free protease inhibitor (Roche) was added to the resuspended cells ...
-
bioRxiv - Cell Biology 2024Quote: ... RT) and subsequently resuspended in 0.5 ml ice-cold vPBS containing EDTA-free protease inhibitor (Roche). 0.5 ml ice-cold 8 % (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5 ml ice-cold 8 % (v/v) paraformaldehyde solution in vPBS containing EDTA-free protease inhibitor (Roche) or ice-cold 8% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... and PCR was conducted using KAPA HiFi DNA Polymerase (Roche Cat. No. KK2601). The verified BLTP2-KO clone was grown in 10cm tissue culture plates and stored as liquid nitrogen stocks for subsequent experiments ...
-
bioRxiv - Cell Biology 2024Quote: ... resuspended in 1 ml vPBS containing EDTA-free protease inhibitor (Roche) and – for widefield microscopy - attached to the poly-L-lysine-coated coverslips by centrifugation (750 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 min) and the cell pellet was resuspended in 1 ml vPBS containing EDTA-free protease inhibitor (Roche). The cells were pelleted again by centrifugation (750 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... and the fixed cells were then resuspended in 1 ml RT vPBS containing EDTA-free protease inhibitor (Roche). The cells were attached to the coverslips by centrifugation (1000 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells which were fixed with 4% paraformaldehyde solution in vPBS containing EDTA-free protease inhibitor (Roche) were first incubated with 0.25 % (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... and then 1 hour with 1.5U/ml αFAM-POD antibody (Roche) diluted in Blocking Buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... 0,51mM dithiothreitol (DTT) and 1× protease inhibitor mixture Complete (Roche)) ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were first incubated 1 hour with Blocking Buffer (10% heat-inactivated Goat Serum, 0.5% Blocking Reagent [Roche] in PBS-0.5% Tween) and then 1 hour with 1.5U/ml αFAM-POD antibody (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... Lactate levels were measured using Cobas C311 Analyzer with LACT2 kits (Roche Diagnostics GmbH). Human Precinorm y Precipath were used as controls.
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cell Biology 2024Quote: ... Abundance of genes of interest was quantified using the SYBR Green-based quantification method (FastStart Universal SYBR Green Mastermix, Roche® Life Science #4913914001) and mRNA abundance was calculated using relative quantification methods (Pfaffl Method ...
-
bioRxiv - Cell Biology 2024Quote: ... 5mM Imidazole) supplemented with complete EDTA-free protease inhibitors (Roche). Cells were lysed by sonication ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with protease inhibitors (Roche, Cat. # 05892970001) and phosphatase inhibitors (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... and phosphatase inhibitors (Roche, Cat. # 04906845001). Cell lysates were stored at -20 °C and cleared by centrifugation at 15000 g for 10 min at 4 °C prior to use ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM MgCl2) completed with complete protease inhibitor cocktail (Roche) and disrupted with a Bioruptor Sonicator by sonication (2 min ...
-
bioRxiv - Plant Biology 2024Quote: ... in the LightCycler 480 (Roche) with the primers listed in Suppl data ...
-
bioRxiv - Plant Biology 2024Quote: ... 50mM imidazole (buffer A) with an EDTA-free protease inhibitor tablet (cOmpleteTM, Roche). Following cell disruption (CF Cell Disrupter (Constant Systems Ltd ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with cOmplete ULTRA and PhosSTOP protease and phosphatase inhibitor cocktails (Roche). Following clearing by centrifugation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were harvested & lysed using RIPA with protease inhibitors (Roche 11836153001) & phosphatase inhibitors (Roche 04906845001) ...
-
bioRxiv - Cancer Biology 2024Quote: Cell lysates were prepared using a 1% triton X-100 containing lysis buffer (CST) supplemented with protease inhibitor cocktail (Roche) on ice for 15 min ...