Labshake search
Citations for Roche :
951 - 1000 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 1 mM DTT and 1x EDTA-free protease inhibitor (Roche)) with a French press ...
-
bioRxiv - Neuroscience 2024Quote: ... using KAPA HIFI PCR Kit (Roche; 07958838001) and primers (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% SDS) supplemented with protease inhibitors (cOmplete™ Protease Inhibitor Cocktail, Roche) and centrifuged at 21000 g for 30 min at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... mitomycin C (Roche Diagnostics) as prophage-inducing reagent [73] was added in triplicates in different final concentrations ...
-
bioRxiv - Microbiology 2024Quote: ... a subsequent ethanol precipitation step with glycogen from mussels (Roche Diagnostics, Basel, Switzerland) as carrier molecule was performed ...
-
bioRxiv - Neuroscience 2024Quote: ... that were amplified by PCR were then subjected to in vitro transcription with either DIG-(#11277073910) or Flu- (#11685619910) RNA labeling mix and T3 RNA polymerase (cat#11031163001) according to the manufacturer’s instructions (Roche). In the case of Cartpt ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with a solution containing horseradish peroxidase (HRP)- conjugated anti-Dig (at a dilution of 1:500; #11207733910, Roche Applied Science) and goat anti-mCherry (at a dilution of 1:250 ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were washed with cold phosphate-buffered saline (PBS) and lysed with NP-40 lysis buffer (P0013F, Beyotime, China) containing protease inhibitor cocktail (04693132001, Roche, Switzerland). Cell lysates were incubated overnight at 4 [with Dynabeads (Sc-2003 ...
-
bioRxiv - Neuroscience 2024Quote: ... blood glucose was measured from tail tip blood with the Accu-Chek Aviva glucometer (Roche, Manheim, Germany). Then ...
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated anti-Dig (at a dilution of 1:500; #11207733910, Roche Applied Science) and a 1:70 TSA-plus Cyanine 3 were used to detect Dig-labeled cRNA probes ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 EDTA-free protease inhibitor tablet added the day of purification (Roche)) ...
-
bioRxiv - Neuroscience 2024Quote: ... remaining tissue was lysed and gDNA amplified by means of PCR (KAPA Biosystems) as described above ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Microbiology 2024Quote: HeLa cells treated with or without CsA were infected with HIV-1 (10 ng p24) that had been treated with 100 U/ml of DNase I (Roche) for 1 h at 37° C ...
-
bioRxiv - Microbiology 2024Quote: ... 1% SDS) containing protease inhibitors (Roche, Laval, QC). The lysates were repeatedly passed through 28 ½-gauge needles to reduce their viscosity and 250 units of benzonase nuclease (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2024Quote: ... and whole-transcription amplification (WTA) with KAPA HotStart HIFI 2 × ReadyMix (Kapa Biosystems) for 20 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... anti-GFP (mouse, 11814460001, Roche). Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416 ...
-
bioRxiv - Microbiology 2024Quote: ... 1 tablet of commercial protease inhibitor cocktail (ROCHE)) and incubated for 30 min on ice ...
-
bioRxiv - Immunology 2024Quote: ... Zfp366_rev#15: TCT GGG AGA GGT CAA ATG GT and universal probe library # 15 (Roche); Actb ...
-
bioRxiv - Immunology 2024Quote: ... Ifnb_rev#95: CAG GCA ACC TTT AAG CAT CAG and universal probe library # 95 (Roche); Ifna ...
-
bioRxiv - Immunology 2024Quote: ... Actb_rev: TGA CAG GAT GCA GAA GGA GA and probe library #106 (Roche).
-
bioRxiv - Immunology 2024Quote: ... Batf_rev#85: CGG AGA GCT GCG TTC TGT and universal probe library # 85 (Roche); Batf2 ...
-
bioRxiv - Immunology 2024Quote: ... Batf2_rev#29: TCT CCA AGG ATT CGT GCT G and universal probe library # 29 (Roche); Batf3 ...
-
bioRxiv - Molecular Biology 2024Quote: ZNF274 expression was induced with 1µg/ml doxycycline and verified via western blot with an anti-HA antibody (1:1000, ref.12013819001, Roche) and anti-beta actin antibody (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... treated with λPPase or that purified from Calyculin A-treated cells was subjected to proteolytic digestion with 0.01 ng/µl trypsin (Roche, sequencing grade) for 0 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 mM Tris-HCl pH 7.4) containing complete protease inhibitor cocktail (Roche) followed by two rounds of differential centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: Site directed mutagenesis of plasmids listed in Table 1 was carried out using KAPA HiFi HotStart premix (Roche) or Tks Gflex DNA polymerase (Takara Bio ...
-
bioRxiv - Neuroscience 2024Quote: ... whole transcriptome amplification by PCR was performed for 12 cycles using KAPA HiFi HotStart ReadyMix (Roche, 7958935001) with a PCR primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% SDS and 125mM sucrose) supplemented with Phos-STOP and protease inhibitors (Roche). The protein concentration of the lysates was determined using a BCA Protein Assay kit (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... The libraries were quantified using the KAPA Library Quantification Kit - Illumina/ABI Prism User Guide (Roche Sequencing Solutions ...
-
bioRxiv - Neuroscience 2024Quote: ... on a LightCycler 480 system (Roche). Expression was calculated by using the 2-ΔΔCt method with Gapdh as housekeeping reference gene ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative PCR reactions were carried out in triplicate with SYBR Green I Master Mix (Roche) on a LightCycler 480 system (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1x cOmplete EDTA-free Protease Inhibitor Cocktail (Roche #11873580001)) and sonicated with 3 rounds of 20s bursts of level 10 amplitude Q55 Sonicator (Qsonica ...
-
bioRxiv - Neuroscience 2024Quote: ... or anti-DIG-POD antibody (11207733910, Roche) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... Then they were incubated with anti-Fluorescein-POD (11426346910, Roche) or anti-DIG-POD antibody (11207733910 ...
-
bioRxiv - Neuroscience 2024Quote: ... Library cleanup was performed prior to and after PCR amplification using 0.8X Kapa Hyperpure beads (Roche 08963851001). PCR amplification was performed with the following parameters as described in the EpiCypher CUT&RUN kit ...
-
bioRxiv - Neuroscience 2024Quote: ... Glycemia was measured using single-use test strips and glycemia meter (ACCU-CHEK Performa, Roche). The tip of the tail of the animal was cut for the first measurement ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cell viability was determined by using the WST-1 assay according to the manufacturer’s instructions (Roche Diagnostics, Mannheim, Germany). After removing the cell supernatants for cytotoxicity measurements ...
-
bioRxiv - Neuroscience 2024Quote: ... and post-fixed in RiboFix (Roche). An anti-DIG-alkaline antibody (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... counterstained using the Red Counterstain II kit (4 min, Roche), removed from the automated system and rinsed with distilled water ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were washed with 0.1X SSC buffer (Roche) three times at 68°C for 12 minutes each ...
-
bioRxiv - Neuroscience 2024Quote: ... in 1x reaction buffer (Roche) and incubating overnight at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Sp6 polymerase (Roche), DIG labeling mix (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... In Situ Hybridization (ISH) was performed using an automated system (VENTANA Discovery, Roche). Paraffin sections were first processed in a series of deparaffination ...
-
bioRxiv - Neuroscience 2024Quote: ... An anti-DIG-alkaline antibody (Roche) was added to the sections ...
-
bioRxiv - Neuroscience 2024Quote: ... 200ng of antisense Pcdh10 probe in Ribohybe (Roche) was added to the sections ...
-
bioRxiv - Neuroscience 2024Quote: ... DIG labeling mix (Roche) and RNase inhibitor (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... rehydration and permeabilization steps (1:3000 Proteinase K (Roche) in PBS-DEPC ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 500µL ice-cold DPBS and 1µL Protector RNAse inhibitor (Roche). For subsequent analysis of mRNA expression via qPCR or bulk RNA sequencing ...