Labshake search
Citations for Roche :
601 - 650 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... the sections were incubated with anti-DIG AP conjugate (Roche; 1:2000) with G-block (diluted 1/50 ...
-
bioRxiv - Microbiology 2024Quote: ... 2.5 μL of 5 μM reverse primer and 10 μL of KAPA SYBR FAST (KAPA Biosystems). The qRT-PCR was done in CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared with the KAPA Stranded RNA-Seq Library Preparation Kit (Kapa Biosystems) and assessed using fragment analyzer (Agilent Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended in 150 μL of resuspension buffer (150 mM NaCl, 50 mM Tris-HCl, supplemented with cOmplete EDTA-free protease inhibitor cocktail [Roche], pH 7.4). For protein identification ...
-
Tryptophan Metabolites And Their Predicted Microbial Sources In Fecal Samples Of Healthy IndividualsbioRxiv - Microbiology 2024Quote: ... Libraries were amplified for 13 PCR cycles in 50 μl reactions containing 150 pmol of P1.1 (5’-AATGATACGGCGACCACCGAGA) and P3 (5’-CAAGCAGAAGACGGCATACGAGA) primer and Kapa HiFi HotStart Library Amplification kit (Cat# kk2612, Roche Sequencing and Life Science). Library quantification and size estimation were performed using a Fragment Analyzer (Agilent Technologies ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... transfection was performed using X-tremeGene HP Transfection Reagent kit (Roche) to introduce 500ng of Halo-RaOp DNA using EBM-2 culture media without antibiotic ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5mg/ml blocking reagent (Roche), and 0.5ug/ml biotinylated LNA probe against SATII (based on the sequence ATTCCATTCAGATTCCATTCGATC (Swanson et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... then resuspended in 880 uL RIPA buffer (1x PBS, 1% NP-40, 0.5% Sodium deoxycholate, 0.1% SGS, Roche protease inhibitor cocktail), and sheared using Covaris E220 Focused-Ultrasonicator ...
-
bioRxiv - Molecular Biology 2024Quote: ... while remaining cells were harvested in 500 µL lysis buffer (50 mM Tris pH6.8, 2% SDS, 1x protease inhibitor (Roche Complete EDTA-free)) snap-frozen and stored at -70 °C until further processing.
-
bioRxiv - Molecular Biology 2024Quote: ... pH 8.0) supplemented with protease Inhibitor (cOmplete EDTA-free, Roche). Cells were lysed as described for the R-DeeP experiment ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1mM DTT) supplemented with protease Inhibitor (cOmplete EDTA-free, Roche). From this point on ...
-
bioRxiv - Neuroscience 2024Quote: ... brain sections were processed for DNA strand breaks using Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) from Fluorescence In Situ Cell Death Detection kit (Roche Diagnostic, Indianapolis, IN) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: Transfection was performed on HEK293T cells using the X-tremeGENE HP DNA Transfection Reagent (Roche) following manufacturer’s manual and viral supernatant was collected 48 hours after transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1% (v/v) Triton X-100) containing 1x cOmplete EDTA-free Protease Inhibitor Cocktail (Roche) and 1x PhosSTOP phosphatase inhibitor (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were washed with PBS and subsequently lysed in RIPA buffer containing protease inhibitor cocktail (Roche). Protein samples were resolved by SDS–PAGE on 4-12% Nu-Page gels (Life Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... in 384-well plates (Roche). The total reaction volume per well was 3 µl ...
-
bioRxiv - Microbiology 2024Quote: ... utilizing LightCycler® 480 SYBR Green I Master Mix (Roche) in 384-well plates (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... The gDNA levels corresponding to the viral genes and the housekeeping wasp gene (elongation factor (ELF-1)) were determined using the LightCycler 480 System (Roche). The cycling conditions involved heating at 95°C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... and lysed by incubation with nondenaturing lysis buffer (300 mM NaCl, 100 mM Tris-HCl [pH 7.4], 2% Triton X-100, and 1×EDTA-free protease inhibitor cocktail [Roche Complete]) for 30 min on ice ...
-
bioRxiv - Cell Biology 2024Quote: ... 40% glycerol and 0.04% bromophenol blue) containing the protease inhibitor cocktail (Roche, 04693132001) and the phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... and the phosphatase inhibitor cocktail (Roche, 04906837001). For separation of soluble and insoluble proteins ...
-
bioRxiv - Cell Biology 2024Quote: ... 2μg ⍺-GFP (Roche) or 0.05 μg ⍺-FLAG (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... interleukin-2 (IL-2; specific activity 10 U/ng) at concentration of 20 ng/mL (Roche) and phytohemagglutinin (PHA ...
-
bioRxiv - Microbiology 2024Quote: ... on the Light Cycler 480 II instrument (Roche Diagnostics).
-
bioRxiv - Microbiology 2024Quote: ... qPCR reactions were performed in 384-well plates (LightCycler 480 Multiwell Plates 384, white, Roche Diagnostics) on the Light Cycler 480 II instrument (Roche Diagnostics).
-
bioRxiv - Molecular Biology 2024Quote: ... Fragments were amplified by PCR in a reaction consisting of 12.5 μL KAPA HiFi HotStart DNA Polymerase (Roche), using 5uM forward and reverse primer pairs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Probes were transcribed with TranscriptAid T7 High Yield Transcription kit (Thermo, KO441) using DIG-Label UTP (Roche,11127073910).
-
bioRxiv - Molecular Biology 2024Quote: ... 1×PhosSTOP phosphatase inhibitor (Roche), 5 µg/mL DNase I (AppliChem ...
-
bioRxiv - Molecular Biology 2024Quote: The following antibodies and dilutions were used for western blotting or immunofluorescence: horseradish peroxidase-linked anti-HA antibody (Roche, 1:5,000), rabbit anti-INTS4 (Bethyl Laboratories ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM DTT supplemented with 1×cOmplete EDTA-free protease inhibitor cocktail (Roche), 1×PhosSTOP phosphatase inhibitor (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... 20 mM EDTA) containing protease inhibitor (cOmplete mini, Roche Cat. 11836153001). After 15 min of incubation on ice ...
-
bioRxiv - Molecular Biology 2024Quote: ... and qPCR was carried out in 5 µL multiplexed reactions and 384-well format using the LightCycler 480 Instrument II (Roche). Final concentration of primers are 0.5 µM and probes are 0.25 µM ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 µl of diluted cDNA was used for each qPCR reaction carried out using KAPA SYBR FAST master mix (Roche). Relative expression levels for each gene were determined based on the 2−ΔΔCT method normalizing against 7SK RNA.
-
bioRxiv - Molecular Biology 2024Quote: ... 25μl 2x KAPA HiFi master mix (Roche, #KK2602), 1μl Partial R1 – CTACACGACGCTCTTCCGATCT (10μM) ...
-
bioRxiv - Microbiology 2024Quote: ... 20 mM EDTA) with protease inhibitor (cOmplete mini, Roche Cat. 11836153001) was added ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed in a LC480 Lightcycler (Roche). A standard curve was prepared using 10-fold serial ...
-
bioRxiv - Microbiology 2024Quote: ... complete mini (Roche) protease inhibitor and PhosSTOP (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... protease inhibitor and PhosSTOP (Roche) phosphatase inhibitor ...
-
bioRxiv - Molecular Biology 2024Quote: ... TMR-red (Roche Diagnostics, Basel, Switzerland) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... or X-tremeGENE HP (Roche # 6366236001), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... blocked with MABT/Block (MABT containing 1% blocking reagent (Roche #11096176001)) for 1 h at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... and developed at RT in BM Purple (Roche 11442074001). Reactions were stopped with PBS and fixed with 4% PFA overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... and incubated with a 1:5000 dilution of alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche 11093274910) in MABT/Block overnight at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... and a Light Cycler 480 Instrument II (Roche) as described previously (111) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The colorimetric reaction was performed by adding NBT/BCIP reagents (Roche) to the alkaline phosphatase buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were then blocked in blocking solution (maleic acid buffer containing 2% Boehringher-Mannheim blocking reagent) and incubated overnight at 4°C in blocking solution containing anti digoxigenin antibody (Roche) diluted at 1:2000 ...
-
bioRxiv - Microbiology 2024Quote: ... For qPCR LightCycler 480 SYBR Green I Master mix (Roche Diagnostics, Vilvoorde, Belgium) was used in final reaction of 15 μL ...
-
bioRxiv - Microbiology 2024Quote: ... Transposon junctions were amplified with oligos pJZ_Fwd_RND1 and olj376 using 500 ng DNA and KAPA HiFi Hotstart Mix (Kapa Biosystems, #KK2602). Reactions were stopped at the inflection point of amplification (6-14 cycles) ...
-
bioRxiv - Microbiology 2024Quote: ... The LightCycler 96 Real-Time PCR System (Roche Diagnostics) was used for amplification with the following thermal cycle conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... and EDTA-free protease inhibitor cocktail (Roche). Protein concentration was measured using the Bradford method (Bio-Rad # 500-0006) ...