Labshake search
Citations for Roche :
851 - 900 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Neutralizing gut-derived lipopolysaccharide as a novel therapeutic strategy for severe leptospirosisbioRxiv - Microbiology 2024Quote: The leptospiral burdens in organs were determined by quantitative PCR using an Applied Bioscience 7500 thermocycler and FastStart Universal SYBR green Master (Roche Applied Science, Germany). The specimens (0.09 to 0.15 g ...
-
bioRxiv - Microbiology 2024Quote: ... qPCR was performed in a LightCycler 96 System (Roche, Basel, Switzerland) with a temperature profile of 180 s at 95°C ...
-
bioRxiv - Neuroscience 2024Quote: ... neurofilament light (NfL) and sTREM2 were measured as part of the NeuroToolKit assay panel in accordance with the manufacturer’s instructions (Roche Diagnostics International Ltd)(64) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 mM Tris-HCl pH 7.4) containing complete protease inhibitor cocktail (Roche) followed by two rounds of differential centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: Site directed mutagenesis of plasmids listed in Table 1 was carried out using KAPA HiFi HotStart premix (Roche) or Tks Gflex DNA polymerase (Takara Bio ...
-
bioRxiv - Molecular Biology 2024Quote: ... The structure of the lacO–tetO reporter locus was checked by a set of 4 PCRs using Expand Long Template PCR System (Roche) and the following primer pairs ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were washed with cold phosphate-buffered saline (PBS) and lysed with NP-40 lysis buffer (P0013F, Beyotime, China) containing protease inhibitor cocktail (04693132001, Roche, Switzerland). Cell lysates were incubated overnight at 4 [with Dynabeads (Sc-2003 ...
-
bioRxiv - Neuroscience 2024Quote: ... blood glucose was measured from tail tip blood with the Accu-Chek Aviva glucometer (Roche, Manheim, Germany). Then ...
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated anti-Dig (at a dilution of 1:500; #11207733910, Roche Applied Science) and a 1:70 TSA-plus Cyanine 3 were used to detect Dig-labeled cRNA probes ...
-
bioRxiv - Neuroscience 2024Quote: ... whole transcriptome amplification by PCR was performed for 12 cycles using KAPA HiFi HotStart ReadyMix (Roche, 7958935001) with a PCR primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Molecular Biology 2024Quote: ... sequencing grade enzyme (Roche) per sample and tryptic peptides were desalted using C18 Sep-Pack Cartridges (Waters) ...
-
bioRxiv - Immunology 2024Quote: ... lungs were digested with DNase (Roche 4536282001) and Liberase (Roche 5401119001 ...
-
bioRxiv - Immunology 2024Quote: ... and Liberase (Roche 5401119001) solution at 37°C for 1h and then smashed using a 70µm Cell Strainer filter (Corning 352350) ...
-
bioRxiv - Immunology 2024Quote: ... Zfp366_rev#15: TCT GGG AGA GGT CAA ATG GT and universal probe library # 15 (Roche); Actb ...
-
bioRxiv - Immunology 2024Quote: ... Ifnb_rev#95: CAG GCA ACC TTT AAG CAT CAG and universal probe library # 95 (Roche); Ifna ...
-
bioRxiv - Immunology 2024Quote: ... Actb_rev: TGA CAG GAT GCA GAA GGA GA and probe library #106 (Roche).
-
bioRxiv - Immunology 2024Quote: ... Batf_rev#85: CGG AGA GCT GCG TTC TGT and universal probe library # 85 (Roche); Batf2 ...
-
bioRxiv - Immunology 2024Quote: ... Batf2_rev#29: TCT CCA AGG ATT CGT GCT G and universal probe library # 29 (Roche); Batf3 ...
-
bioRxiv - Molecular Biology 2024Quote: ZNF274 expression was induced with 1µg/ml doxycycline and verified via western blot with an anti-HA antibody (1:1000, ref.12013819001, Roche) and anti-beta actin antibody (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... treated with λPPase or that purified from Calyculin A-treated cells was subjected to proteolytic digestion with 0.01 ng/µl trypsin (Roche, sequencing grade) for 0 ...
-
bioRxiv - Microbiology 2024Quote: HeLa cells treated with or without CsA were infected with HIV-1 (10 ng p24) that had been treated with 100 U/ml of DNase I (Roche) for 1 h at 37° C ...
-
bioRxiv - Microbiology 2024Quote: ... 1% SDS) containing protease inhibitors (Roche, Laval, QC). The lysates were repeatedly passed through 28 ½-gauge needles to reduce their viscosity and 250 units of benzonase nuclease (Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2024Quote: ... the purified DNA was mixed with SYBR Green master mix (Roche) and specific primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... The following qPCR protocol was used on the LightCycler® 96 (Roche): 3 min of activation phase at 95°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1x protease inhibitor (Roche)) and subjected to sonication (Qsonica ...
-
bioRxiv - Molecular Biology 2024Quote: ... eGFP (mouse 1:2000, 11814460001, Roche) and Pgk1-HRP (mouse ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with PhosStop (Roche) and cOmplete Protease Inhibitor Cocktail (Roche) ...
-
bioRxiv - Physiology 2024Quote: ... pancreas was distended by cannulizing the bile duct to infuse 2.5ml of collagenase P (0.66mg/ml in Hank’s Balanced Salt Solution) (Roche, catalog number C7657), surgically removed and incubated at 37°C for 15 minutes under constant agitation ...
-
bioRxiv - Neuroscience 2024Quote: ... and 10% sucrose) supplemented with protease (Complete, EDTA free, Roche Diagnostics, USA) and phosphatase inhibitors (1 mM Sodium orthovanadate ...
-
bioRxiv - Neuroscience 2024Quote: ... A control homogenated with PBS and protease inhibitor (PI) cocktail (complete EDTA-free tablet, Roche) was included to assess the role of endogenous proteases ...
-
bioRxiv - Neuroscience 2024Quote: ... with 200 U/mL of Protector RNase Inhibitor (Roche). Remaining submerged in the dissection medium ...
-
bioRxiv - Molecular Biology 2024Quote: ... Monosome fractions were pooled and treated with 200 μg/mL Proteinase K (Roche) and 1% sodium dodecyl sulfate at 50 °C for 30 min ...
-
bioRxiv - Plant Biology 2024Quote: ... qPCR reactions were run in a Light Cycler 96 (Roche) Real-Time PCR machine ...
-
bioRxiv - Plant Biology 2024Quote: ... The results of samples were analysed by Roche LightCycler 480 Real-Time software program ...
-
bioRxiv - Plant Biology 2024Quote: ... and the relative quantification was calculated based on Advance Relative Quantification provided by the LightCycler®480 (software release 1.5, Roche Diagnostics). Finally ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... 2% b-mercaptoethanol) and cOmpleteTM mini EDTA-free protease inhibitor cocktail (Roche, #04693159001) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 mM EDTA) supplemented with 1x protease inhibitor (complete EDTA free, Roche), 2.5% [w/v] polyvinylpyrrolidone 40 (PVP40) ...
-
bioRxiv - Plant Biology 2024Quote: ... 1x Complete Protease inhibitor (Roche, San Francisco, CA, USA) [60] and adjusted to 150 mM NaCl.
-
bioRxiv - Plant Biology 2024Quote: ... 0.5% sodium deoxycholate) supplemented with protease inhibitor (cOmplete™, Roche), 1 mM DTT and 1 mM PMSF ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... 0.1% NP-40) containing 2 μM MG-132 and cOmpleteTM mini EDTA-free protease inhibitor cocktail (Roche, #04693159001) for 30 minutes at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... a peroxidase-coupled anti-HA antibody (1:10,000; Roche, Cat. 12013819001) was employed.
-
bioRxiv - Neuroscience 2024Quote: ... RNA has been retro-transcribed to cDNA using oligo-dT and Transcriptor reverse transcriptase (Roche) according to manufacturer recommendations.
-
bioRxiv - Neuroscience 2024Quote: ... Genomic PCR for ATP13A2 floxed or KO alleles was performed using 100 ng genomic DNA and the Kapa2g Fast HotStart PCR Kit (Roche). PCR primers included a forward primer (5’-CTGCAGCTTCGAGAGGAAAG-3’) ...
-
bioRxiv - Neuroscience 2024Quote: ... GFP (A-11122; Thermofisher or 11814460001; Roche or GFP-1010; Aves Labs), GAD67 (MAB5406 ...
-
bioRxiv - Neuroscience 2024Quote: Primary antibodies used for Western blotting include GFP (11814460001; Roche), pThr73-Rab10 (ab230261 ...
-
bioRxiv - Neuroscience 2024Quote: ... midazolam (5 mg/kg body weight; Dormicum, Roche) and medetomidine (0.5 mg/kg body weight ...
-
bioRxiv - Physiology 2024Quote: ... FDB muscles were extracted from mouse footpads and digested in 1.3 mg/ml collagenase A (Roche Diagnostics, Indianapolis, IN, USA) in Ringers solution containing 146 mM NaCl ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 mM PMSF and protease inhibitors (Ultra Easy Pack, Roche), and extraction was allowed to proceed for 2 h at 4°C with shaking ...
-
bioRxiv - Plant Biology 2024Quote: ... the lysate was clarified by centrifugation at 12,000 x g and 4°C for 15 min and then filtered using a 0.45-µm syringe filter (Roche). The filtered lysate was passed over a gravity-flow column packed with 0.5 ml amylose resin (New England Biolabs ...