Labshake search
Citations for Roche :
551 - 600 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 1x cOmplete EDTA-free protease inhibitor (05056489001, Roche, DB-DP) with 0.1% Triton-X ...
-
bioRxiv - Microbiology 2024Quote: ... N-Glycosidase F (Roche, #11365185001) was diluted 1:10 in serum-free IMDM and incubated with the cells for two hours at 37°C prior to fixation ...
-
BTK and MMP9 regulate NLRP3 inflammasome-dependent cytokine and NET responses in primary neutrophilsbioRxiv - Immunology 2024Quote: ... the amount of LDH released during the in vitro experiments were quantified using the kit Cytotoxicity Detection Kit (LDH) provided by Roche. Triton X-100 (Applichem ...
-
bioRxiv - Cell Biology 2024Quote: ... and visualized using rat anti-HA monoclonal antibody (3F10; Roche) and anti-rat IgG antibody (A9037 ...
-
bioRxiv - Cell Biology 2024Quote: ... X-tremeGENE™ HP DNA Transfection Reagent (Roche) was used according to the manufacturers protocol ...
-
bioRxiv - Immunology 2024Quote: ... collagenase P 2 mg/mL (Roche, Mannheim, Germany, #11213857001), then carefully removed ...
-
bioRxiv - Microbiology 2024Quote: ... The qPCR experiments were performed using specific oligonucleotide primers previously described[24] and hot-start polymerase (SYBR Green Fast Master Mix; Roche Diagnostics). The amplification cycles were performed using a C1000 Touch Thermal cycler (Biorad) ...
-
bioRxiv - Neuroscience 2024Quote: ... Pefabloc (Roche, Basel, Switzerland, #30827997) and Halt Protease and phosphatase inhibitor (Thermo scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 30 μm sections were stained according to instruction of In situ Cell Death Detection Kit (Roche, Basel, Switzerland, #11684817910). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... and detected using the DIG system (Roche). Oligos for probe preparation are listed in Table S3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein was detected with 1:3,000 horseradish peroxidase-conjugated anti-HA (Roche, cat#12013819001) or anti-GFP (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... or 0.4 - 0.5 x volume KAPA PURE SPRI beads (Roche, Basel, Switzerland).
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative PCR was performed on a Roche LightCycler 480 using KAPA SYBR FAST qPCR MasterMix (Roche: KK4611).
-
bioRxiv - Cell Biology 2024Quote: ... and 0.05 mg/ml DNase I (Roche)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... finely cutting and digesting them in 0.025 mg/ml Liberase (Roche) for 15 min at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... The sections were immediately covered with 20-60 µL primary antibody in Triton-Wash buffer (20mM HEPES pH 7.5,150mM NaCl, 2mM spermidine and Roche complete EDTA-free protease inhibitor) added dropwise ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the bead-bound homogenate was resuspended in up to 1 mL Triton-wash buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 0.2mM EDTA, 0.05% Triton-X100 and Roche EDTA-free protease inhibitor) and divided into PCR tubes for antibody addition ...
-
bioRxiv - Immunology 2024Quote: ... and Collagenase D (1 mg/mL, Roche) at 37°C for one hour ...
-
bioRxiv - Molecular Biology 2024Quote: Harvested cell pellets were lysed in 1xRIPA buffer supplemented with 1x EDTA-free cOmplete protease inhibitor (Roche) and 1x PhosphoSTOP phosphatase inhibitor (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1x PhosphoSTOP phosphatase inhibitor (Roche) for 30 minutes on ice with two rounds of 15 second vortexing ...
-
bioRxiv - Molecular Biology 2024Quote: ... and RNA was released from the membrane using Proteinase K (Roche, 03115828001). RNA was purified using neutral phenol/chloroform/isoamylalcohol (Ambion ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM MgCl2 (Roche Diagnostics), 0.3 µM of each primer (RB1_80F and RB1_235R ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500,000 HUVEC were washed with CUT&RUN wash buffer (20 mM HEPES pH 7.9, 150 mM NaCl, 500 nM spermidine, 1X Roche Protein Inhibitor Cocktail) at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... all tissue sections were stained with DAPI (4’, 6-Diamidine-2’-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). Images were taken with a confocal microscope from Zeiss (LSM 880 Airyscan).
-
bioRxiv - Molecular Biology 2024Quote: ... and purified with quick spin RNA columns (Roche, Indianapolis, IN). Biotin-labeled RNA or unbiotinylated RNAs was dissolved in RNA structure buffer (10 mM Tris ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1× Complete Protease Inhibitor Cocktail (05056489001, Roche).
-
bioRxiv - Molecular Biology 2024Quote: ... Biotinylated RNAs were transcribed in vitro with Biotin-RNA Labeling Mix (Roche, Indianapolis, IN) and purified with quick spin RNA columns (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... GFP-tagged Myh was isolated from cell lysate using Dynabeads Protein G (Thermo 10004D) and GFP-tag Antibody (Roche #11814460001). IP and input were boiled in 5xLaemmli Buffer and separated on an SDS-PAGE (8-16% ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries for high throughput sequencing were made by PCR using KAPA HiFi HS ReadyMix (Roche) from genomic DNA (Qiagen blood and tissue kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... To detect for DNA containing complementary sequences on membrane-bound DNA a α-32P-dCTP-labelled probe spanning the region of 37-611 nts on human mtDNA was synthesized using High Prime DNA Labeling Kit (Roche). After pre-hybridizing the membrane with Church’s buffer (250 mM NaPi pH 7.2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was amplified using the 2X KAPA Taq ReadyMix PCR Kit (KAPA Biosystems, now Roche Sequencing, Indianapolis, IN) for 35 cycles using an annealing temperature of 64°C ...
-
bioRxiv - Neuroscience 2024Quote: ... BSA (2mg/ml, Roche), and 1X SSC ...
-
bioRxiv - Neuroscience 2024Quote: ... Triton 0.01X) supplemented with a protease inhibitor cocktail (#11873580001, Roche Diagnostic). Samples were then sonicated (2 ×3 s ...
-
bioRxiv - Neuroscience 2024Quote: ... alkaline phosphatase-conjugated antibody (Roche). The sections were subsequently rinsed and incubated in the dark with a NBT/BCIP solution (Nitroblue tetrazolium chloride/ 5-bromo-4chloro-3-indyl-phosphate ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Neuroscience 2024Quote: ... The sections were subsequently rinsed and incubated in the dark with a NBT/BCIP solution (Nitroblue tetrazolium chloride/ 5-bromo-4chloro-3-indyl-phosphate; Roche) until the staining appeared (overnight or up to 48 h) ...
-
bioRxiv - Microbiology 2024Quote: ... The membranes were exposed to chemiluminescence detection films (Roche Diagnistics, Rotkreuz, Switzerland). Detection of actin served as loading control for the lysate.
-
bioRxiv - Microbiology 2024Quote: RNAs were extracted 48 hours after RNP transfection using the High Pure RNA Isolation Kit (Roche) according to instructions of the manufacturer ...
-
bioRxiv - Microbiology 2024Quote: ... (4) we used KAPA HiFi master mix (Roche, 07958935001) and 19 cycles of PCR.
-
bioRxiv - Microbiology 2024Quote: ... in 384-well plates (Roche). The total reaction volume per well was 3 µl ...
-
bioRxiv - Microbiology 2024Quote: ... utilizing LightCycler® 480 SYBR Green I Master Mix (Roche) in 384-well plates (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... The gDNA levels corresponding to the viral genes and the housekeeping wasp gene (elongation factor (ELF-1)) were determined using the LightCycler 480 System (Roche). The cycling conditions involved heating at 95°C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... The cells were lysed by adding Lysozyme (MP-Biomedicals) and DNase I (Roche Applied Sciences) and incubating them on ice for 30 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... The RT-qPCR was carried out using SYBR green master mix (Roche Applied Science) in a QuantiFast light cycler (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems, Wilmington, MA), 0.3 mM of each primer and 1 µL of DNA template (20 ng µL-1) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10µl of ECM degrading enzyme Dispase-ii (Roche) was applied to the exposed mesodermal surface for 5 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and 100 ng were used for paired-end Illumina sequencing library preparation using the KAPA HyperPlus Library Preparation Kit (Roche) and the KAPA Unique Dual-Indexed Adapater Kit (Roche) ...