Labshake search
Citations for Lucigen :
1701 - 1750 of 2345 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... 1 μl of the Gibson reaction was delivered to 25 μl of electrocompetent EnduraTM cells (Lucigen, cat. no. 60242-2) using Gene Pulser®/MicroPulser™ Electroporation Cuvettes ...
-
bioRxiv - Genomics 2021Quote: ... 1 U/μL Rnase Inhibitor (Lucigen, #F83923), 2.5 μM Template-Switching Oligo primer ...
-
bioRxiv - Genomics 2021Quote: ... 10 µL of RNase Inhibitor (Lucigen, #F83923) was added per 1 mL suspension immediately before microfluidic encapsulation ...
-
bioRxiv - Microbiology 2021Quote: ... two ml of a culture grown in R2B were used for extraction of high molecular weight (HMW) DNA using the MasterPureTM DNA Purification Kit (Epicentre, Madison, WI, USA), using the kit’s protocol for cell samples ...
-
bioRxiv - Microbiology 2021Quote: ... filled with 1 ml LB supplemented with 25 μg/ml chloramphenicol and 2 µl/ml CopyControl fosmid autoinduction solution (Epicentre Biotechnologies, Cat. No. AIS107F). The plates were grown at 30 °C shaking at 700 RPM for 16 h covered by an AeraSeal gas-permeable sheet (EXCEL Scientific Cat ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... gargle solution or sputum sample were mixed 1:1 with 2x QuickExtract DNA extraction solution (Lucigen) and heat inactivated for 5 minutes at 95°C ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were harvested using Quick Extract solution (Lucigen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant phagmids were electroporated into TG1 cells (Lucigen, USA). A VHH library of 7.3 × 106 individual clones was obtained.
-
bioRxiv - Cell Biology 2021Quote: ... cloni 5-alpha (short: E. cloni, Lucigen corporation) for all cloning procedures ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the plates was used for quick genomic DNA isolation for each of the colonies using QuickExtract DNA extraction solution (Lucigen # QE09050). 5μl of this lysate was used to set up a quick genomic PCR screening for IL-1β knockout clones using checking primers ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre #QE09050) and nested PCR performed ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.1 mL 40 U/mL RNasin (Lucigen, Middleton, WI), and 0.6 mL nuclease-free water (Thermo Fisher Scientific ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 10X transcription buffer (Epicentre Technologies Madison, WI), 3 μL of S-35-labeled UTP ...
-
bioRxiv - Biochemistry 2021Quote: ... CLIC1 was expressed recombinantly in the C43 E.coli strain (Lucigen). The cells were lysed by sonication ...
-
bioRxiv - Biochemistry 2021Quote: ... and Ampligase (Epicentre). Reactions were digested with DpnI for 3 hours at 37 °C to remove methylated template vectors.
-
bioRxiv - Biochemistry 2021Quote: Kirbac3.1 was expressed in C41(DE3) (Lucigen Cat# 60442) E ...
-
bioRxiv - Biochemistry 2021Quote: ... coli (Lucigen, Middleton, WI, USA). Two additional panning rounds were conducted (for the 2nd and 3rd rounds respectively ...
-
bioRxiv - Biochemistry 2021Quote: ... and 10G (Lucigen) electrocompetent cells ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell lysates were prepared using the EasyLyseTM bacterial protein extract solution (Lucigen Corp. USA) or the CelLytic B reagent (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... while prokaryotic mRNA was enriched by removing rRNA by Ribo-Zero™ Magnetic Kit (Epicentre, Madison, USA). Then the enriched mRNA was fragmented into short fragments using fragmentation buffer and reverse transcripted into cDNA with random primers ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen E. cloni 10G); post-heat shock recovery time was limited to 15-20 minutes to avoid cell division during recovery and ensure that each resulting colony was the result of an independent transformation event ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen E. cloni 10G). Around 800 thousand colonies were recovered ...
-
bioRxiv - Systems Biology 2021Quote: ... We performed nine electroporations of the column-purified plasmid into Endura electrocompetent Escherichia coli cells (Lucigen) using a Gene Pulser Xcell (Bio-Rad) ...
-
bioRxiv - Systems Biology 2021Quote: ... 80% of a confluent 96-well was harvested and lysed in QuickExtract (Lucigen). In short ...
-
bioRxiv - Genomics 2021Quote: ... The libraries were amplified with 10 PCR cycles using the FailSafe PCR enzyme (Illumina/Epicentre). Libraries were quality controlled on a TapeStation 2200 HSD1000.
-
bioRxiv - Cancer Biology 2021Quote: ... 1 µl from ligation reaction was added onto 25 µl of electrocompetent cells (Lucigen) and cells were transformed by using Electroporator (Bio-Rad MicroPulser ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated with 1U of RNase H (Hybridase Thermostable RNase H, Epicentre), purified using RNA Cleanup XP beads (Agencourt) ...
-
bioRxiv - Genetics 2021Quote: ... The mycobacteriophage used for knockout was obtained using MaxPlax packaging extract (Epicentre Biotechnologies, Madision, WI, USA) and a katG knockout strain was obtained by phage transduction ...
-
bioRxiv - Molecular Biology 2021Quote: ... phosphorylated DNA using the End-It DNA End-Repair Kit (Lucigen). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Synthetic Biology 2021Quote: ... CircLigase™ was purchased from Lucigen. Snap-Cap Microcentrifuge Biopur™ Safe-Lock™ or Safe-Lock Tubes 2 mL were from Eppendorf™ ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... Ready-Lyse Lysozyme (47 U/μl; Epicentre), and 1× PIC (Sigma-Aldrich) ...
-
bioRxiv - Pathology 2021Quote: ... then gDNA was extracted using the MasterPure Gram Positive DNA Purification kit according to manufacturer’s protocol (Lucigen). Library preparation and sequencing was performed by the Microbial Genome Sequencing Center (MiGS) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and T erminator 5’-Phosphate Dependent Exonuclease (Lucigen) (1 U per 5 μg of RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Terminator 5’-Phosphate Dependent Exonuclease (Lucigen) (1 U per 5 μg of RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... we treated these samples with 5’ polyphosphatase (Lucigen) (20 U per 5 μg of RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Each aliquot was either enzymatically treated with 5’ polyphosphatase (Lucigen) (20 U per 5 μg of RNA ...
-
bioRxiv - Cell Biology 2021Quote: ... the ribosomal RNA (rRNA) was removed using the Epicentre Ribo-zero® rRNA Removal Kit (Epicentre) with a total amount of 2 ug RNA as an input for each library ...
-
bioRxiv - Developmental Biology 2021Quote: ... approximately 30,000 cells were lysed in 25ul Quick Extract Buffer (Lucigen #QE09050), according to the manufacturer’s directions ...
-
bioRxiv - Developmental Biology 2021Quote: ... the left RNAs were treated with RNase R (Epicentre Inc, Madison, WI, USA) to remove linear RNAs and to enrich circRNAs ...
-
bioRxiv - Developmental Biology 2021Quote: ... QuickExtract 30-60 µl (Epicentre, QE0905T) was added to the cell pellets or organoids and the suspension was incubated at 65°C for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... coli DnaB and mutants (R74A, R164A, K180A, R328/329A) were independently expressed in C41 strain (Lucigen, Middelton, WI) from pET11b-derived plasmids as previously described [4] ...
-
bioRxiv - Biochemistry 2021Quote: ... Linear PCR products were ligated by blunt-end ligation using the Fast-link DNA ligation kits from Epicentre. 5μl of the ligation reaction were used for the transformation of chemically-competent E ...
-
bioRxiv - Biochemistry 2021Quote: ... pure DNA was isolated by using the MasterPure™ Gram Positive DNA Purification Kit (Epicentre, Illumina, San Diego, CA, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... Fungal genomic acid DNA was isolated with the MasterPureTM Yeast DNA Purification Kit (Lucigen, Wisconsin, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 3U of Baseline-ZERO (Epicentre, USA), 30U of Benzonase (Novagen ...
-
bioRxiv - Genetics 2021Quote: ... The remainder was self-ligated using Fast-link ligase (LK0750H; Lucigen), after which duplets of ~800bp were excised from agarose gel and purified (BIO-52059 ...
-
bioRxiv - Genetics 2021Quote: ... The purified DNA fragments were then blunted and phosphorylated using End-It DNA End-Repair Kit (#ER0720; Epicentre). Part of the repaired pool was set apart for cloning of singlet libraries ...
-
bioRxiv - Neuroscience 2021Quote: ... adding CopyControl solution (EpiCentre) 2 hrs before the miniprep ...
-
bioRxiv - Microbiology 2021Quote: ... Circ Ligase (Epicentre, cat. No. CL4111K), NEBNext® High-Fidelity 2X PCR Master Mix (cat ...